1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jolli1 [7]
3 years ago
15

What is the equation of a line that is tangent to the circle (x + 1)2 + (y −2)2 = 10 at the point (0, 4)

Mathematics
2 answers:
KengaRu [80]3 years ago
6 0

Answer:

2x+-4y=10

Step-by-step explanation:

Stells [14]3 years ago
6 0
The answer would be 2x+(-4)=10
You might be interested in
You bought 8 movie tickets for $x each. You spent a<br> total of $42 at the movies.
charle [14.2K]
8 divided by 42 = 5.25 which means you spent $5.25 on each ticket
3 0
2 years ago
You need 8 oz of red paint and 12 oz of blue paint to make purple paint. How much red paint is needed for 15 oz of blue paint?
olga2289 [7]

Answer:

10oz

Step-by-step explanation:

Solve

<h2>\frac{8}{12} = \frac{x}{15}</h2><h2>x=10</h2><h2></h2>
4 0
3 years ago
There are 12 students in a classroom, including the triplets joey, chloe, and zoe. If 3 of the 12 are randomly selcted to give s
BARSIC [14]
The probability of Joey being first is 1/12. If that happens the probability of Chloe going next is 1/11. Then the probability of zoe being picked next would be 1/10. Then if you multiply all the fractions I gave you you would get 1/1320 which is A. So A. Is your answer!! Hope this helps you out!!
8 0
3 years ago
Read 2 more answers
Kim has a hundred jackets 25 scarves and 168 pairs of shoes. Each shoe has 7 buttons. How many buttons are on Kim shoes. Find th
Virty [35]

Answer:

there whould be 1176 botone on all the pairs combined

Step-by-step explanation:

hope this will help

7 0
3 years ago
What is the slope of the line represented y= 5x -7​
Wittaler [7]

The slope is 5. This is because the coefficient of x is the slope of a line.

7 0
3 years ago
Read 2 more answers
Other questions:
  • 2. Given: 2(x– 9) = -10; Prove: X= 4<br> What are the reasons
    10·1 answer
  • .
    5·2 answers
  • A scientist is studying the relationship between the depth of a watermelon vines’ roots and the weight of the watermelons produc
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Change y=e^(-x^2) to x=
    14·1 answer
  • (x) 3 5 7 <br> (y) 7 11 15 <br><br> Find x, when y = 21
    12·1 answer
  • After a heavy snowfall, Joe and Karin made an igloo. The dome of the igloo is in the shape of a parabola and the height of the i
    9·1 answer
  • The perimeter of a rectangular garden is 37.5 feet. The width is x, and the length is 15 ft. Use the equation 2(x + 15) = 37.5 t
    14·2 answers
  • On a particular day, the wind added 3 km per hour to Alfonso's rate when he was cycling with the wind and subtracted 3 km per ho
    13·1 answer
  • What does the width of a sphere mean? Given the width of a sphere, How do you find the volume?​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!