1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
3 years ago
7

Describe the difference between how sickle cell anemia is inherited versus how best disease is inherited. what causes this diffe

rence?
Biology
1 answer:
defon3 years ago
8 0
Well, basically we can say that <span>Best Disease expresses itself more through the generations. The reason for that is because it is dominant. While we may say that the allele of the sickle cell anemia its indeed a recessive trait with 0% of chances, Best desease is a dominant trait with 50% of chances.</span>
You might be interested in
What do u mean by unit cell and crystal lattice.
mafiozo [28]
Unit cell: The simplest arrangement of atoms or molecules that regularly repeat in a crystal structure

Crystal lattice: A crystal lattice is a three dimensional atomic structure for the solid phase of matter.

Characteristics of a crystal lattice include
Symmetrical and infinitely repeating arrangement of atoms

hope this helps
5 0
3 years ago
I NEED HELP ASAP.
shusha [124]

Answer:

First picture (of baby and parents) is reproduction, the third picture (kid at doctor) is growth, I'm not sure about the others.

Explanation:

8 0
3 years ago
Read 2 more answers
Which compound is inorganic
Inessa [10]

Answer:

H2O

Explanation:

It's not made of carbon

4 0
4 years ago
A group of tissues working together in a related fashion is called
ruslelena [56]
The answer to this question would be: an organ

A group of a similar cell will make a tissue, but a group of tissues will be called an organ. In the organ, there is various tissue that will work together to do a function.
In the heart, the muscle tissue will contract and pump the blood. The connective tissue will make the valve so the blood will be pumped in one way direction. Every tissue will do different jobs and if you lose one of them it will decrease the organ capability.
6 0
4 years ago
2.Which of the following structures would you expect to find in a single-celled
Amiraneli [1.4K]
B. outer covering
b. it preforms all functions

6 0
3 years ago
Read 2 more answers
Other questions:
  • What is an example of a scientific theory
    5·1 answer
  • Computational biology encompasses numerous other fields, including bioinformatics, computational biomodeling, computational geno
    6·1 answer
  • What is a stage of both technological design and scientific investigation?
    12·2 answers
  • Write THREE difference between aerobic and anaerobic respiration?​
    7·2 answers
  • Why is mutation beneficial to the process of evoloution?
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Kelp ________. is eaten by sea otters is eaten by orcas suffers intense herbivory from zebra mussels suffers intense herbivory f
    5·1 answer
  • State the principle sources of energy for this food web.
    7·1 answer
  • :)))))))))))))))?:))))))))?
    14·1 answer
  • correctly identifies at least one item that produces each of the five percussive tones (resonance, hyperresonance, dullness, fla
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!