1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
HACTEHA [7]
3 years ago
12

In an experiment, it was found that newborn rats who were genetically predisposed to be skittish, nervous, and high-strung would

develop into calm, exploratory, and stress-resistant adult rats when raised by genetically unrelated, attentive mothers. Although the rats' DNA did not change, the chemicals that controlled their gene expression did change, a phenomenon called: a) epigenetic change. b) allele variation. c) recessive gene mutation. d) dominant gene mutation.
Biology
1 answer:
Pepsi [2]3 years ago
8 0

Answer:

a) epigenetic change.

Explanation:

Epigenetic is referred to changes BESIDES the changes in the genetic changes. It means, not related to mutations but to chemical changes such as methylation, acetylation, ubiquitylation, phosphorylation, that can interfere with the genetic expression. Chromatin modification is another way of epigenetic change.

You might be interested in
All BUT one of the conditions will increase the reaction rate of an enzyme. The Condition that will NOT increase the reaction ra
zlopas [31]

Answer;

C) decreasing the concentration of an enzyme

Explanation;

-Environment factors such as temperature and pH affects the activity of an enzyme. Changing these conditions alters the rate of the reaction caused by the enzyme.

-Each enzyme works at certain optimal conditions such as optimal temperature and optimal pH, thus increasing temperature and pH to optimal levels will increase the rate of enzyme reaction.

-Changing the concentration of enzyme and substrate will also affect the rate of reaction of an enzyme-catalyzed reaction. Increasing enzyme concentration increases the rate of enzyme activity.

8 0
3 years ago
Read 2 more answers
(HELP ME)
Mariulka [41]

Answer:

The answer is fossils.

3 0
3 years ago
In North America, a toxic weed called leafy spurge was accidentally introduced and has grown and spread rapidly, covering millio
tankabanditka [31]

Answer:

c. The flea beetle can become an invasive species

Explanation:

An invasive species is a non-native species that is introduced to the population (for example by humans). Because they are non-native, they can disrupt the 'natural order' of things. I.e., they can change the function of the ecosystem, which develops naturally to result in a harmony.

In this example, the leafy surge is a good example of an invasive species, it was accidentally introduced and has grown out of control, damaging the range land. In an attempt to control this, we deliberately introduced <em>another non-native species</em>.

This is in an attempt to fix the original mistake. If it works, then great! But if the flea beetles don't actually eat the leafy spurge, and they reproduce so quickly... it means we have introduced an additional species that could also disrupt the ecosystems. This could then mean that the flea beetle becomes an invasive species.

7 0
3 years ago
True or False: The cells that make up your body have the same DNA.
svp [43]

Answer:

True

Explanation:

Pls Give Brainlest Thanks

6 0
3 years ago
Read 2 more answers
Do plant cells contain mitochondria
Bingel [31]
Yes cells do include mitochondria.
4 0
4 years ago
Other questions:
  • Which of the following is not evidence for the law of conservation of mass during cellular respiration?
    7·1 answer
  • Which of the listed relationships between groups is correct?
    12·1 answer
  • What are the characteristics of viruses that distinguish them from other organisms?
    10·1 answer
  • During photosynthesis, oxygen is converted to carbon dioxide. True False
    5·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following fur colors are possible in females? Choose all that apply:
    7·1 answer
  • 8. Short Answer Why is 'seahorse' not a good scien-<br> tific name?
    13·1 answer
  • Photosynthesis and cellular
    13·1 answer
  • Which phrase best describes the rock’s texture
    5·1 answer
  • How is dna structured
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!