1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
2 years ago
5

During respiration, a seed metabolizes sugars. what is the source of the sugar metabolized by the seed?

Biology
1 answer:
pashok25 [27]2 years ago
8 0

The source of the sugar metabolized by the seed is photosynthesis.  

The procedure used by plants to transform light energy into a chemical form of energy is known as photosynthesis. The chemical energy can afterward be discharged to fuel the plants to perform their activities.  

During photosynthesis, carbon dioxide and water can be combined in the existence of chlorophyll and sunlight to generate oxygen and glucose (carbohydrates). However, the prime component generated in the procedure is glucose (sugar) that is the molecule, which generates energy to mediate the activities of the cell.  


You might be interested in
The level of security in terms of the corresponding bit length directly influences the performance of the respective algorithm.W
natulia [17]

Answer:

what is the question you basicly just gave us a paragraph to comment on

Explanation:

3 0
3 years ago
The lower the pH the stronger the ______ ?
fiasKO [112]

Answer: ACID

Explanation:on the Ph scale their is acids and bass' the loewer the Ph is hte higher the acid will be

5 0
2 years ago
Sam and his Dad were trying to combat the fire ants in the backyard. They tried several brands of fire ant "killing" chemicals b
Harman [31]

Answer: Tbh i dont rlly know But i think it might be C. do grits work better at illing ants than commercial products?

If im wrong srry!

Hope this helps!

Explanation:

6 0
3 years ago
Which of these animal would most likely produce antifreeze compound in its cell?
algol13
Antarctic fish. To stop their blood from freezing, some fish that live in the arctic and Antarctic have special Antifreeze proteins. Antifreeze proteins are very clever, as they slow down the formation of bonds between water molecules, which prevents the formation of ice crystals in the fish's blood. 
5 0
3 years ago
Explain the relationship between the second law of thermodynamics and the net energy of an
Anton [14]

Answer:

The Second Law of Thermodynamics is about the quality of energy. It states that as energy is transferred or transformed, more and more of it is wasted. The Second Law also states that there is a natural tendency of any isolated system to degenerate into a more disordered state

is that helpful?

4 0
2 years ago
Other questions:
  • Is most of the tubule filtrate reabsorbed into the body or excreted in urine explain?
    10·1 answer
  • When prokaryotic bacterial cells undergo cell division, the single circular chromosome replicates to form a second chromosome. T
    13·1 answer
  • Chromosomes appear during which<br> phase of mitosis
    12·2 answers
  • What are light absorbing molecules that plants use to gather the suns energy called?​
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which of the following describes a collection of specialized organs?
    9·1 answer
  • Pls help it’s for science
    15·2 answers
  • Select all of the following that describe passive transport
    12·1 answer
  • Please help me I really need it!!5. Read the scenarios below. For each of the scenarios, identify the following (you should iden
    7·1 answer
  • Fill in the blank
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!