1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mestny [16]
3 years ago
13

The disorder that is characterized by a very high level of blood sugar and onset prior to adulthood is

Biology
1 answer:
MAVERICK [17]3 years ago
4 0
The answer would be <span>insulin-dependent diabetes mellitus.</span>
You might be interested in
A behavioral adaptation is...<br> Give at least 2 examples
sweet [91]

Answer:

no

Explanation:

because

3 0
3 years ago
Mendel crossed purebred purple-flowered plants with purebred white-flowered plants, and all of the resulting offspring produced
ElenaW [278]
The offspring are all heterozygous, and the allele for purple flower is dominant
7 0
3 years ago
What enzyme removes unneeded clots after healing has occurred?
GalinKa [24]

The right answer is plasmin.

Plasmin is a peptidase that catalyzes the hydrolysis of peptide bonds located preferentially after a lysine residue or an arginine residue. In this respect, it has greater selectivity than trypsin.

This enzyme intervenes by lysing fibrin in the process of fibrinolysis, an essential step of blood coagulation. It is derived from the activation of plasminogen by urokinase and tissue plasminogen activator.

8 0
3 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
Were the germans the first to send up a satellite into space?
evablogger [386]
No, it was the Soviet Union that launched the first satellite, "Sputnik".
4 0
3 years ago
Other questions:
  • A protein is a chain of linked smaller molecules called
    5·1 answer
  • Which tools do scientists typically use to collect images of Earth's surface?
    14·1 answer
  • Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the tot
    9·1 answer
  • Where does all energy in most food webs come from?
    14·1 answer
  • In certain cells, a transport protein moves one calcium ion out of the cell against its concentration gradient while allowing th
    15·2 answers
  • Characteristics such as strength or the ability to find food often become more common in populations over time because individua
    6·2 answers
  • How many amino acids are found in living organisms
    12·2 answers
  • 2. Why are humans considered animals?
    15·1 answer
  • WILL GIVE BRAINLIEST!
    12·1 answer
  • What are the major types of physical and biological evidence for climate change?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!