1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Art [367]
3 years ago
8

What is a highly conserved protein

Biology
1 answer:
Tanya [424]3 years ago
6 0
A highly conserved protein in something that is conserved. it means it could be found in multiple species that have been distantly related :)
You might be interested in
A lizard with a striped tail and a normal head crossed with one having a normal tail and a spotted head produce all normal (no s
mel-nik [20]

Answer:

9 normal : 3 striped : 3 spotted : 1 striped and spotted

Explanation:

4 0
3 years ago
What is the surface composition of Uranus?
ohaa [14]
Answer:


Uranus is made of water, methane, and ammonia fluids above a small rocky center. Its atmosphere is made of hydrogen and helium like Jupiter and Saturn, but it also has methane. The methane makes Uranus blue.
7 0
3 years ago
Which of these has only prokaryotic cells?
bixtya [17]

fungi is a prokaryotic

4 0
3 years ago
So my teacher assigned us a volcano project and she is asking us what the frequency of our volcano is, I chose the volcano Mauna
balandron [24]

Ok I will help you I just gotta look it up real quick
3 0
3 years ago
consider other shapes for a cell besides a cube? what cell shape might increase . surface area and decrease the volume explain
Vaselesa [24]
Answer - Well to put it in short terms. 

Cells such as water cells or aquatic microorganisms need and required to have a large surface area increased. Because this helps them stay afloat without spending much amount of energy to float.

6 0
3 years ago
Other questions:
  • Which would be a result of increased deforestation?
    13·2 answers
  • How does the ear work (the three different segments in the ear)
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are examples of proteins? Select All that apply
    9·2 answers
  • Which answer choice correctly lists the level of organization from most basic to most complex
    6·1 answer
  • During photosynthesis, water molecules absorb energy from the sun. What do you think this energy does to the water molecule?
    10·1 answer
  • Which sequence shows increasing complexity of ecological organizations
    7·1 answer
  • CAN SOMEONE HELP ME PLASE ITS URGENT !!!
    13·1 answer
  • Do you mind to help me plzzz?<br> What are advantages and disadvantages of sexual reproduction?
    11·2 answers
  • Fleas and mosquitoes sometimes transmit disease pathogens such as bacteria and viruses from one individual to another. Such agen
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!