1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaVladis [17]
2 years ago
11

Elastic fibers are important to muscle tissue since they resist excessive stretching and help muscle fibers spring back to its o

riginal length after being stretched. Elastic fibers are important to muscle tissue since they resist excessive stretching and help muscle fibers spring back to its original length after being stretched. True False
Biology
1 answer:
brilliants [131]2 years ago
8 0

Answer:

True

Explanation:

Elastic fibers are composed of elastin, myofibrils and fibrillin. They are distributed <u>separately</u>, and therefore do not form bundles(they actually form a kind of mesh), like collagen fibers.

Elastic fibers are usually thin and long and can stretch up to 1.5x of their total length.

These fibers confer elasticity to the connective tissue. The mesh formed of elastic fibers easily yields to minimal tensions, returning to its original shape as soon as the deforming forces cease.

An example of the action of elastic fibers is when we pull the skin from our hands and release it, the elastic fibers are responsible for quickly returning the skin to its original shape.

You might be interested in
Which statement is true about exotic species? They help to support the native species. They increase biodiversity of native spec
svetlana [45]
Answer - They can threaten the biodiversity of native.

Reason - Reason being they can threaten to the native is due to the invasive, reproduction, no predator to kill. Which leads to economic problems and environmental issues. :)
7 0
3 years ago
Widespread hunting of predators may results in _____.
marusya05 [52]
It may result to endangering that animal. Hope you enjoy your awnser!
4 0
3 years ago
Read 2 more answers
What is the botanical name of pawpaw​
natka813 [3]

Answer:

Carica Papaya

hope this answer helps you...

5 0
3 years ago
Read 2 more answers
In coccidioidomycosis, _______ containing many endospores form in the lungs.
dolphi86 [110]

Answer:

spherules

Explanation:

Like histoplasmosis, coccidioidomycosis is acquired by the inhaling fungal spores.

<u>Arthrospores are formed by the hyphal fragmentation in this case. Once in body, fungus differentiates into the spherules which are filled with the endospores. </u>

Most of the C. immitis infections are self-limiting and asymptomati. The endospores are transported in blood, disseminating infection and thus leading to formation of granulomatous lesions on face and nose. I

<u>Thus, spherule is a thick-walled spherical structure which encloses the endospores and occurring in parasitic form of the fungi of genus Coccidioides.</u>

7 0
3 years ago
In a small hospital in yokadouma, cameroon, a 24-year-old woman named prudence died in childbirth. which would not be considered
Misha Larkins [42]

Options for the question have not been given. They are as follows:

A. a lack of urban health care capacity

B. cultural disregard for women and women's health

C. prudence's family medical history

D. a lack of previous medical problems

Answer:

C. prudence's family medical history

Explanation:

Sociological factors include the factors related to human society. These factors stem from the way a society functions and effects the people which are a part of it. The way the society is structured and developed, impacts the people.

Prudence died during childbirth. There can be many sociological causes of her death like low status of women or poor medical facilities in her society. However, her family medical history will not be considered a sociological factor. Family medical history also depends on other factors like genetic composition of the family which is not a sociological factor.  

8 0
3 years ago
Other questions:
  • How does the environment impact if an organism shows signs of life?
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which blood vessels will have walls only one cell thick?
    9·1 answer
  • BRAINLIESTTT ASAP!!<br><br> please answer
    11·1 answer
  • Which of the following stages of regulatory control in eukaryotes largely occurs in the cytoplasm, outside of the nucleus?
    11·1 answer
  • Acetylcholine receptors on skeletal muscles are described as being ionotropic receptors because _____.
    12·1 answer
  • Plsss helps plss <br><br> Extra 20 points
    12·1 answer
  • All sells need water to survive in order to How do you maintain the necessary amounts water blows across the cell membrane from
    5·1 answer
  • Translation is the process of protein synthesis using mRNA produced during transcription. The process involves three stages:
    8·1 answer
  • After a volcano erupts and destroys an ecosystem, a few organisms are able to begin growing from the decaying organic matter lef
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!