1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
7

Help me help me ..........

Biology
2 answers:
elena-14-01-66 [18.8K]3 years ago
8 0

Answer:

D

Explanation:

yanalaym [24]3 years ago
8 0

Answer:

D

Explanation:

You might be interested in
Distinguish ecological pyramids from food webs and food chains?
MrRissso [65]

Food chains follow a single path as animals eat each other while ecological Pyramids are graphical representation of the tropic structure of ecosystem. Plants feed herbivores, herbivores feed carnivores. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

4 0
3 years ago
Evolution is:
fiasKO [112]
A, b, and c are all correct.

take for example finches off of the galapagos islands. they vary from island to island, yet are still the same bird. on one island they have bigger, more durable and stronger beaks, because that island has many nuts to crack open and eat. on another island, they have thin ling beaks, ideal for pecking at insects in the grass on tree bark. evolution is literally survival of the ifttest, where those equipped best will live and those without means to fight for life will die off, leaving those most capable of reproduction and passing down genes.
3 0
4 years ago
What are the parent genotypes
Andre45 [30]

Answer:

A dominant allele is denoted by a capital letter (A versus a).Since each parent provides one allele, the possible combinations are: AA, Aa, and aa. Offspring whose genotype is either AA or Aa will have the dominant trait expressed phenotypically, while aa individuals express the recessive trait.

7 0
3 years ago
When are scientist ideas modified
dlinn [17]
Scientist ideas are modified when scientist find more information through experimenting and the scientific method
4 0
3 years ago
In h.323, which protocol below handles call or videoconference signaling?​
scoray [572]
H.225 is the protocol that handles call or videoconference signaling. H<span>.225.0 is a key protocol in the H.323 VoIP architecture defined by ITU-T. H.225.0 describes how audio, video, data and control information on a packet based network can be managed to provide conversational services in H.323 equipment by Vangie Beal.</span>

 

 





8 0
3 years ago
Other questions:
  • As DNA replication begins the DNA molecule is broken apart into two ________ strands.
    14·2 answers
  • With their lack of gills, dolphin must surface every 10-15 minutes to breathe using a structure called a blowhole located on the
    13·2 answers
  • What is the best description of homologous chromosomes?
    11·1 answer
  • The bees wing are moving very fast the best wings are much smaller than it body ?
    14·1 answer
  • If an island had 1000 cats on it, an ecologist would use the word _______ to describe all the members of that species
    13·1 answer
  • In what way are plants in a sunny meadow and sulfur bacteria in a deep sea vent alike
    9·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Observing the picture predict how the water will move and what will happen to the cell.
    10·1 answer
  • What phenotype would a plant with the genotype Pp have?
    13·1 answer
  • Which is a use for peat moss?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!