1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
15

A plant cell is a eukaryotic cell. True or false? Pleaser help please I need help

Biology
2 answers:
Mamont248 [21]3 years ago
7 0
True in a way...Plant and animal cells are eukaryotic, meaning that they have nuclei. Eukaryotic cells are found in plants, animals, fungi, and protists.
arlik [135]3 years ago
5 0

Answer:

true!

Explanation:

plants and animals have eukaryotic cells.

You might be interested in
One of the most common types of bacteria-related diarrhea in the united states, resulting primarily from the ingestion of contam
strojnjashka [21]

hemorrhagic colitis -caused by E.coli, most common in children, severe abdominal cramps, vomiting, diarrhea, and a short-lived fever followed by watery, bloody diarrhea. Sources of E.coli; beef, unpasteurized milk, unpasteurized apple juice or cider, raw sprouts, dry cured salami, fresh produce, yogurt, sandwiches, water.

5 0
4 years ago
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?
d1i1m1o1n [39]
UACCGCUCCGCCGCUCGACAAUACC
5 0
3 years ago
Why do the absorption spectrum for chlorophyll and the action spectrum for photosynthesis coincide?
AveGali [126]
Wavelengths of light that are absorbed by chlorophyll trigger the light capturing reactions
3 0
4 years ago
Which scientist developed the idea that small Adams combine to form molecules
Nataly [62]

Answer:

John Dalton

Explanation:

7 0
3 years ago
The relationship between weathering and erosion can best be characterized as
skelet666 [1.2K]
<span>Weathering loosens material before erosion carries away, but erosion can also scour and move unweathered material.</span>
4 0
4 years ago
Other questions:
  • sort the items according to whether they may be found only in free virus particles, only in uninfected host cells, or in both vi
    13·1 answer
  • Use the codon chart to convert this sequence into an amino acid: UCU-CGA-GCC-GUU-GGG-UGA
    12·2 answers
  • I'm the diastole phase of the cardiac cycle, which is the correct direction of the flow of blood?
    13·1 answer
  • Is the following sentence true or false ? The temperature of the outer thermosphere is quite high...
    6·1 answer
  • A grocer stocks cans of vegetables on a shelf. The peas are in cans that have a circular bottom with an area of 9.42 square inch
    15·2 answers
  • Which of the following is NOT a function of proteins?
    9·1 answer
  • Which of the following statements about archaea are true cowan?A) They are prokaryotes.B) They lack peptidoglycan in their cell
    5·1 answer
  • SCIENCE HELP!!!!!!!!!!
    12·2 answers
  • Describe the causes of coral reef habitation destruction
    5·1 answer
  • How does abiotic and biotic factors influence an ecosystem?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!