1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
3 years ago
5

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Biology
1 answer:
d1i1m1o1n [39]3 years ago
5 0
UACCGCUCCGCCGCUCGACAAUACC
You might be interested in
Describe the region or states affected by the occluded front?
Leviafan [203]
The state that affected by the occluded front is nyc
6 0
3 years ago
Read 2 more answers
Explain how the alleles were passed from<br> parents to offspring.<br> I<br> DONE<br> ) Intro
gtnhenbr [62]

answer is the first1 off spring to parants

4 0
3 years ago
Read 2 more answers
What dietary changes would facilitate food intake for those with oral cavity problems?
Dimas [21]

Answer:

Good oral health and diet

fruits. vegetables. lean sources of protein such as lean beef, skinless poultry and fish; dry beans, peas and other legumes. low-fat and fat-free dairy foods.

Explanation:

5 0
3 years ago
) if you flip the light switch in your living room and nothing happens, what might be a good hypothesis to explain the absence o
scZoUnD [109]
It may be the default in light.........
8 0
3 years ago
Nonrandom mating tends to _______ the frequencies of ______ genotypes.
scZoUnD [109]
The correct answer would be A or the first option
6 0
4 years ago
Read 2 more answers
Other questions:
  • Ovules are found within structure _____. A flower contains definite structures labeled from A to E. Letter A marks structures si
    12·1 answer
  • After creating a hypothesis, what is the next step in Mary and Jim's investigation?
    7·2 answers
  • In what layer does plasticity and convection occur?
    7·2 answers
  • Explique de que forma a obstrução dos vasos da planta hospedeira pelos biofilmes de bactérias pode levar à morte progressiva das
    8·1 answer
  • _____ is the slightly movable articulation between the sacrum and posterior portion of the ilium
    6·1 answer
  • Which of the following are capable of converting transforming chemical energy stored in glucose?
    9·1 answer
  • Why are elbow and knees Called hinge joint?<br> What are some disorders that can occur in joint
    10·1 answer
  • What is the male reproductive system cell
    10·1 answer
  • Question 9 of 25
    11·1 answer
  • Choose all of the items needed to complete a circuit ​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!