1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Klio2033 [76]
2 years ago
8

based on the size scale indicate by the micrographs in a cellular slime mold fruiting body a millimeter - micrometer-, or nanome

ter-scale structure? how does the size of a fruiting body compare with that of the cells you observe earlier?
Biology
1 answer:
lara [203]2 years ago
3 0

Slime Molds. ... A distinguishing morphological difference between the two groups is the vegetative state of cellular slime molds in a haploid amebiod cell, whereas the vegetative state of acellular slime molds is a multinucleate diploid ameboid mass called a plasmodium.

You might be interested in
What is Kingdom Monera?
Tomtit [17]

Answer:

Monerais a kingdom that contains unicellular organisms with a prokaryotic cell organization (having no nuclear membrane), such as bacteria.They are single-celled organisms with no true nuclear membrane (prokaryotic organisms).

Explanation:

5 0
3 years ago
From your knowledge about the distribution of electrons in the levels and from the atomic number (in parentheses), indicate the
rjkz [21]
Oxygen forms an ion with the charge (-2)
5 0
3 years ago
Read 2 more answers
Which of these pollutants is transferred from soil to water by fertilizer runoff from farms and leaky septic tanks?
daser333 [38]
I think the correct answer from the choices listed above is the last option. The pollutant that <span>is transferred from soil to water by fertilizer runoff from farms and leaky septic tanks would be nitrates. This pollutant is present in fertilizers and are produced from reactions in a leaky septic tanks. Hope this answers the question.</span>
8 0
3 years ago
Read 2 more answers
PLEASE BE QUICK!! I’M TIMED!!
Firlakuza [10]

Answer: i thi

Explanation:

4 0
2 years ago
Read 2 more answers
What are meristematic tissues?
svetlana [45]
Meristematic tissue is the dividing tissue present at the growing regions of the plants. They are meant for growth of an organ Cells of meristems divide continuously and help in increasing the length and girth of the plant
The cells of this tissue are similar in structure and have thin cellulose cell walls
The cells do not contain any intercellular space between them 
The cells contain few vacuoles or no vacuoles at all
They are further divided in the following parts
1)Apical meristem
2)Lateral meristem
3)Intercalary meristem
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why does sickle-cell hemoglobin (HbS) migrate slower than normal hemoglobin (HbA) during gel electrophoresis?
    6·1 answer
  • A physical oceanographer studies all of the following except:
    15·2 answers
  • 10. Which greenhouse gas is the most powerful absorber of the radiation emitted by
    9·2 answers
  • In multicellular organisms, cells are organized into tissues, tissues into organs, organs into organ systems, and systems
    14·1 answer
  • How does the range of phenotypes difference between single gene trait and polygenic traits
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is Homologous evolution and Analogous evolution give its example !<br><br>Spam✔️​
    7·2 answers
  • Modern age is the Age of Science and Technology. Justify the statement.​
    11·1 answer
  • 1. A girl rides her bike for 4 hours at a speed of 40 km/h. What distance did<br> she travel?
    15·1 answer
  • GIVING BRAINLIEST!!!!!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!