1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
6

WhO WaNTs sOmE MoRe pOiNtS aNd A bRaInLiEsTtTtT

Biology
1 answer:
Romashka [77]3 years ago
8 0

Answer:

me i do

Explanation:

You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Which object is likely to have the most value based on the concept of scarcity?
givi [52]

Answer:

crop of oranges

Explanation:

5 0
3 years ago
Read 2 more answers
Hydro power is another source of renewable energy. It relies on two forms of energy involved in falling or flowing water. Identi
Eduardwww [97]

Answer:

Potential and kinetic energy

Explanation:

Hydropower use to potential energy and kinetic energy to produce electricity. It uses the potential energy of the water store in dam and this potential energy is the energy posses by an object at rest. The potential energy is now converted to kinetic energy when the water begin to flow through it pipes and began to turn the turbines which then convert it to mechanical rotation of the turbine.

5 0
3 years ago
Which is an example of asexual reproduction in plants
Levart [38]
An example would be potatoes because they reproduce asexually through their roots.

4 0
3 years ago
Read 2 more answers
PLS HELP! WILL GIVE BRAINLIEST
kow [346]

Answer:

I think that the best graph to represent it would be the second graph.

Explanation:

Hope this helps!! :)

5 0
3 years ago
Read 2 more answers
Other questions:
  • During meiosis, independent assortment determines which chromosomes a gamete inherits, while ____________ determines, within a c
    12·1 answer
  • Chemoreceptors in the circulatory system detect changes in circulating pCO2. If CO2 concentrations get too high, the rate of ven
    15·1 answer
  • Life in Earth’s biosphere is limited by all of the following except _____. A. temperature B. sea level C. pressure D. oxygen ava
    5·2 answers
  • Which of the following is a possible reason for migration?
    9·2 answers
  • What is the world formula of photosynthesis? The chemical formula?
    7·1 answer
  • Temperature, sunlight, and water are examples of _____. mineral sources abiotic factors biotic factors food sources
    15·2 answers
  • Which INCREASE gas exchange? (choose all correct) Group of answer choices: a) increased pressure gradient for carbon dioxide exc
    11·1 answer
  • If there is a disease that has to do with oxygen/carbon dioxide exchange, where is the issue?
    7·1 answer
  • Why do most washing powders have proteases as their enzyme ​
    12·1 answer
  • Which statement about enzymes is true? O An enzyme functions to decrease the rate of a chemical reaction.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!