1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goryan [66]
3 years ago
13

A nurse recalls that the blockage of dopamine by antipsychotic drugs can cause extrapyramidal side effects such as akathisia. wh

ich client behaviors reflect the presence of akathisia?
Biology
1 answer:
Karo-lina-s [1.5K]3 years ago
5 0
<span>Akathisia is the inability to sit still. People will tend to be uneasy and want to be doing something. They'll be fidgety, looking for something to do with their hands, or be looking to get up and walk around.</span>
You might be interested in
Which part of the cell surrounds the cell and allows molecules in and out this cell part also has holes in it and is said to be
mina [271]
That would be the cellular membrane
6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Which one of the following nucleotide pairs would be found in a DNA molecule?
MrRa [10]

Guanine-cytosine is one of the  nucleotide pairs that would be found in a DNA molecule. The other is Adenine- Thiamine.

Explanation:

Pyrine bases – Adenine & Guanine-  pair with pyrimidines bases – Cytosine and Thiamine. Adenine pairs with Thiamine while Cytosine pairs with Guanine.

In RNA, however, while this same principle of base pairing is observed, rather than Thinmaine, RNA has Uracil in its place. Therefore, in RNA, Adenine pairs with Uracil. There is no Thiamine in RNA.

Learn More:

For more on base-pairing check out;

brainly.com/question/2739575

brainly.com/question/10444320

#LearnWithBrainly

8 0
3 years ago
Which organelle prepares proteins for specific jobs?
oksian1 [2.3K]
Ribosomes.
Proteins are used for cellular repairing and chemical processes. Ribosomes are one of the most important organelles in the cell, mostly part of the rough endoplasmic reticulum. It manufactures enzymes such as proteins which will be utilized by many organelles in the cell. Microtubules are one, responsible for the framework and acts as a skeleton of the cell –cytoskeleton needs proteins, also cytoplasm and other organelles of the cell. For a prokaryote or a eukaryote cell to survive, they need protein.<span> Fundamentally, the cell would cease to function and possibly die</span>
8 0
4 years ago
When using a pocket mask, the rescuer would be positioned at the side of the victim?
Reil [10]
<span>True. Pocket mask is otherwise known as CPR mask, pocket face mask is a device used for the artificial ventilation during a cardiac arrest. When giving aid the mask should be applied to the patient's face using thumbs of both hands. Then stand on one side of the victim and give rescue breaths.</span>
5 0
3 years ago
Other questions:
  • The ultimate purpose of the digestive system is to:
    6·1 answer
  • PLEASE HELP ME!!
    12·1 answer
  • According to the theory of evolution, birds' feathers evolved from.
    13·1 answer
  • Which substance is a fuel used in nuclear power plants?
    8·1 answer
  • Which natural event can occur either over a few weeks or over a few million years?
    12·1 answer
  • Professional psychological associations require researchers to minimize infection, illness, and pain in animal subjects.
    5·2 answers
  • Stretch marks are the result of tears in the integumentary layer that contains fibrous connective tissue, elastin, and collagen.
    10·1 answer
  • As you increase the temperature, the rate of photosynthesis increases and then decreases.
    14·2 answers
  • Bacteria are
    15·1 answer
  • What kind of neurotransmitter is serotonin ?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!