1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
3 years ago
8

Do animals get periods? Like females?

Biology
1 answer:
Westkost [7]3 years ago
3 0
Yes most of them do. That is one of the main reasons why dogs get spayed/neutered. In order to give birth, You need to of had your period first. So the animals that can give birth have a period. I don't know how long it is though. I am also not sure about fish, just mammals.
You might be interested in
Why is there a thermocline in ocean waters?
Rom4ik [11]
Water pressure and temperature varies at different depths of the ocean.
8 0
3 years ago
Which structure has the active sites where the heads of the thick filaments will bind?
Gre4nikov [31]
THE ACTIN has the active site to which the heads of the thick filament will bind.
The muscle is made up of two major protein fibers, which are the actin and the myosin. Muscle contractions occur when myosin and actin slide over each other in a series of repetitive events. The protein actin has a thin structure and is abundant in eukaryotic cells while myosin is a thick filament.
7 0
3 years ago
Science help plz! Giving brainlist :D
Blababa [14]
Radiation. hope that helped
7 0
3 years ago
Fill in the blanks: The original organism is called the _____________, and new organisms are called the _____________.
NARA [144]

Answer:

The original organism is called the <u><em>parent (ancestor)</em></u> , and new organisms are called the <u><em>offspring</em></u>.

Explanation:

Reproduction is one of the characteristics of life. Every living organism tends to give rise to another organism. The organism which gives rise to another organism is termed as the parent. The organism which is born is known as the offspring.

There are two basic methods of reproduction. An organism can give rise to another organism by the method of asexual or sexual reproduction.

During asexual reproduction, identical copies of the parent organism are made. During sexual reproduction, two organisms reproduce to produce non-identical offsprings.

8 0
3 years ago
41) a particular triplet of bases in the template strand of dna is 5' agt 3'. the corresponding codon for the mrna transcribed i
KiRa [710]

A particular triplet of bases in the template strand of DNA is 5' agt 3'. the corresponding codon for the mRNA transcribed is<u> 3' UCA 5'</u>

<u></u>

It serves as a link between DNA's genetic code and proteins' amino acid sequences.

The codons in the messenger RNA (mRNA) are complementary to the nucleotide sequence on the DNA template strand.

Then it controls the synthesis of amino acids with the aid of tRNA and ribosomes.

Its name, messenger RNA, refers to the fact that it carries genetic information. The single strands of adenine, cytosine, guanine, and uracil that make up the mRNA molecule are held together by a sugar phosphate backbone.

Two codons: His, Lys, Phe, Tyr, Asn, Asp, Cys, Gln, Glu, Codons Ile, STOP, and three ("nonsense"). Ala, Gly, Pro, Thr, and Val are the four codons. None of the five codons.

Learn more about mRNA:

brainly.com/question/24885193

#SPJ4

3 0
1 year ago
Other questions:
  • Autotrophs produce food through what process?
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which best describes radiometric dating?
    11·2 answers
  • 15. Processes are: light dependent stage and Calvin cycle. *
    5·1 answer
  • Compared to a parallel circuit, a series circuit has which of the following disadvantages? A A series circuit requires more mate
    15·1 answer
  • PLZ HURRY I HAVE TO FINISH MY HOMEWORK IF I WANT TO GO HORSEBACK RIDING TOMORROW
    8·2 answers
  • what is the distribution of earthquakes and volcanoes over the surface of the earth. are they scattered at random or they concen
    15·1 answer
  • Why do you think some people still become ill even after taking strong precautions against an illness, such as receiving a vacci
    7·2 answers
  • Which statement best describes the term biodiversity?
    6·1 answer
  • According to the Universal Law of Gravitation, every object attracts every other object in the universe. Why can't you feel the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!