Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Antagonsitic effect/interaction/response
In order to combat antiobiotic resistance, and to possibly enhance the activity of antibiotics, they are sometimes used in combinations during treatment. However, three possible responses or effects can manifest.
First is antibiotic synergy, where the combined effect of the antibiotics enhances the activity/potency of the treatment compared to when the antibiotics are administered singly.
The effect is also distinguished from another type of response, which is additive effect, where the combined effect of the antibiotics is more or less equal to the combined activity/potency of each of the antibiotic when applied singly. Antibiotic synergy results in even greater enhancement of the activity of the combined antibiotics compared to additive effect.
Lastly, there is the antagonistic effect or response, where the combined effect of the antibiotics results in the weakening of the potencies of the antibiotics relative to the combined (additive effect) potencies of each of the antibiotics.
The difference is how much each can transport and how much the accelerated gene pools resuscitate.
