1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
15

Rebecca tells tom that he is singing “off pitch.” rebecca is referring to which physical property of sound?

Biology
1 answer:
Ray Of Light [21]3 years ago
6 0

Rebecca tells Tom that he is singing “off pitch.” Rebecca is referring to Frequency of sound.

Frequency is measured as the number of wave cycles that occur in one second. It is defined as the speed of the vibration and this further determines the pitch of the sound. This is usually useful for musical sounds where there is a strong waveform.

You might be interested in
Witch steps are important when designing and conducting a scientific experiment
enot [183]
The scientific method :)

8 0
3 years ago
Which of the following is not a major conclusion of the US Army Corps of Engineers' report on Hurricane Katrina?
Arlecino [84]

Answer:

D

Explanation:

Got it right :)

4 0
3 years ago
Read 2 more answers
Which part of the digestive system illuminates solid wastes From the human body
dimulka [17.4K]

Answer:

The large intestine eliminates solid wastes that remain after the digestion of food. The liver breaks down excess amino acids and toxins in the blood.

Explanation:

6 0
3 years ago
A mushroom that you see above ground is actually a
tatiyna
<span>A. fruiting body.
</span>
Mushroom is an example of a heterotroph. 

Autrophs are the organisms that have the capacity to form their own food from inorganic substances like the carbon dioxide. 
<span>Heterotrophs are the organisms that cannot produce their own food but depends on other animals or plants for their nutritional needs. </span>
7 0
3 years ago
Question 21 of 25
agasfer [191]
C. Glucose

Because of the word equation
5 0
1 year ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • American bullfrog habitat
    7·2 answers
  • Match the phases in the cell cycle to the events that occur in each phase. interphase mitosis cytokinesis the nucleus divides ar
    9·2 answers
  • Which meal would provide the most energy, and includes the material needed to build muscle? a. bread and butter b. lettuce and o
    7·1 answer
  • Binary fission can sometimes be advantageous in evolutionary processes, allowing new daughter cells to adapt to different enviro
    13·1 answer
  • Which of these statements is true about adaptive evolution? The ability to learn plays a key role in the process of adaptive evo
    14·1 answer
  • What are the 4 divisions of plants?
    7·1 answer
  • A toy boat is floating in a large metal bucket. if you build a fire under the bucket, how will most of the heat be tranferred fr
    15·1 answer
  • You are looking through a microscope at stained cells that appear to have a stiff outer edge and smaller structures inside, incl
    11·1 answer
  • What is the order of the blood vessels as the blood leaves the heart, travels to a tissue, and then returns to the heart?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!