1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ann [662]
3 years ago
15

Which stage is labeled C in the diagram?

Biology
2 answers:
goblinko [34]3 years ago
7 0

G2 Phase......................................

Arada [10]3 years ago
5 0
Oh wait, I know which one you are talking about. The answer would be D. The G2 Phase. Hope this helped! :)
You might be interested in
I need help plzzzzz plsnvkrnxivmwjicj
baherus [9]

Answer: c

Explanation:

i just got done with that test

6 0
3 years ago
These diagrams demonstrate how cells can be differentiated by their
exis [7]

Answer:

c I think because I remember this from a while ago

5 0
3 years ago
Read 2 more answers
How fast was the planetesimal going in kilometers per hour when it collided with Earth?
Firlakuza [10]

Answer:it covers this route at a speed of nearly 30 kilometers per second, or 67,000 miles per hour. In addition, our solar system--Earth and all--whirls around the center

Explanation:

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
What major biomolecule is this fertilizer preventing?
Amanda [17]

Answer:

there are 4 major classes of biological macromolecules

3 0
2 years ago
Other questions:
  • Food production in the twentieth century has tripled because of industrialized agriculture, and most people spend much less time
    9·2 answers
  • Describe two methods that scientists can use to determine whether two species (modern or extinct) are closely related.
    6·1 answer
  • A racecar begins its first lap on a racetrack. After seven seconds, it is 140 meters further east. What is the average velocity
    12·1 answer
  • Approximately how many known neurotransmitters are there
    14·1 answer
  • When something is_____ it is<br>used to make something else.<br>it is processed and then​
    12·1 answer
  • Plz help
    5·2 answers
  • Approximately what percentage of practicing veternarians work as large animal veternarians in the united States
    11·1 answer
  • Mr. Carter draws a box with a particle diagram of a liquid on the whiteboard. Next, he draws another box with a particle diagram
    11·1 answer
  • Urea and uric acid are products of the breakdown of:
    6·1 answer
  • GlaxoSmithKline would become more ________ if it starts allowing its lab scientists to set the priorities and allocate the resou
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!