1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
14

What characteristic is shared by both inceptisols and entisols, the soils of flood plains? a. They both have well-developed soil

horizons and profiles. b. Both are young and only beginning to develop horizons and a soil profile. c. They are both at the final stage of soil development. d. None of the above
Biology
1 answer:
Sergio039 [100]3 years ago
5 0

Answer:

D. none of the above

Explanation:

I am a student on ed=genuity and I just took thee test and passed flying colors.

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Because it is difficult to excrete iron once it is in the body, iron balance is maintained primarily through absorption. The iro
Rzqust [24]
<h2>The given statement is true</h2>

Explanation:

Iron absorption occurs in the duodenum and upper jejunum of small intestine

  • At physiological pH ferrous iron is rapidly oxidized to the insoluble ferric form
  • Gastric acid lowers the pH in the duodenum which enhances the solubility and uptake of ferric iron
  • Once iron gets inside the enterocyte it can be stored as ferritin;Ferritin is a hollow spherical protein which helps in storage and regulation of iron levels within the body
  • Ferritin molecule have ferroxidase activity which helps in the mobility of Fe2+ out of the enterocyte by ferroportin
  • Transferrin is the major iron transport protein which transports iron through blood
  • Fe3+ binds to transferrin so Fe2+ transported through ferroportin must be oxidized to Fe3+
  • Fe2+ needs to be oxidized first so that it can be transported through ferroportin
  • Once iron gets inside the cell it can be used for various cellular processes
6 0
3 years ago
Original DNA strand: ATT GAG CC Mutated DNA strand: ATT GAG CT What type of mutation does the example above demonstrate?
otez555 [7]
The first mutation is substitution and the second is deletion
4 0
3 years ago
When Hurricane Marilyn struck the Caribbean islands in 1995, a group of about 15 green iguanas floated on storm debris from the
ladessa [460]
Reproduce and soon take over the island with the ancient power if iguanas, jk jk

though they will reproduce it will depend on the food source and if there is a food source since they are introduced to a new environment they most likely won't have any predators and can eat and move freely as much as they want to.

I hope this helps
 
3 0
3 years ago
Read 2 more answers
When the cells of most organisms freeze, they burst. whitch property of water cause this to occur?
xz_007 [3.2K]
<span>Cells of most organisms freeze due to the fact that. Water is less dense as a solid than as a liquid. To elaborate when you quickly freeze and organism the internal portion of that organism is freezing at a much slower rate. SO the outside portion becomes rigid eventually breaking is you freeze it at a slower rate less cells will be damaged.</span>
6 0
3 years ago
Other questions:
  • Help Me Out With This Question Plz Thanks!!!​
    13·1 answer
  • In which phase do homologous chromosomes migrate to towards the metaphase phase?
    9·1 answer
  • List three ways that spacesuits provide protection to astronauts.
    9·2 answers
  • A six-year old spent the day eating sweets. he ate cookies for breakfast, ice cream for lunch and candy for supper. how did his
    15·1 answer
  • Parts of cell (a-d)​
    5·1 answer
  • Bacteria divide at a constant time interval called the
    13·1 answer
  • Identify what structures in a skeletal muscle will shorten in length during contraction of the muscle.
    14·1 answer
  • What organ system stores mineral reserves and provides a site for blood cell formation?
    8·1 answer
  • What are the two claims about living creatures made by the Theory of Biological Evolution?
    10·1 answer
  • Were the gases used to create Earth's primitive Oceans and what were the contents of the liquid pool after the experiment ran fo
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!