1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
5

If the length of the absolute refractory period in cardiac muscle cells was the same as it is for skeletal muscle cells, _______

_.
a) it would be much longer before cardiac cells could respond to a second stimulation
b) contractions would last as long as the refractory period pacemaker cells would cease to spontaneously depolarize
c) tetanic contractions might occur, which would stop the heart's pumping action
Biology
1 answer:
WINSTONCH [101]3 years ago
7 0

Answer:

Answer is C. Tetanic contraction might occur which would stop the heart's pumping action.

Explanation:

Tetanic contraction occurs when the muscle fiber doesn't fully relax before it contracts again due to repeated stimuli at short intervals.

You might be interested in
What is incomplete dominance
Vikki [24]

Answer:

Incomplete dominance is when a dominant allele, or form of a gene, does not completely mask the effects of a recessive allele, and the organism's resulting physical appearance shows a blending of both alleles. ... Note that this is different from codominance, which is when both alleles are expressed at the same time.

Explanation:

8 0
2 years ago
Q1: An important function of the respiratory system is to:
Helga [31]
ANSWER: D




—


EXPLANATION:
3 0
3 years ago
What do scientist do if there hoptestisis is wrong?
Amiraneli [1.4K]
If a HYPOTHESIS is wrong scientists come up with a conclusion, the hypothesis doesn't matter for the result. It is just an educated guess based on the results they expect our hope the achieve.
4 0
3 years ago
How does a virus differ from a common cell?Immersive Reader It has no nucleus, cell wall, or organelles. It has two nuclei and n
melamori03 [73]
A bc FGF bf d no if Harry
3 0
3 years ago
Read 2 more answers
What is the correct sequence of molecules involved in protein synthesis from beginning to end?
xz_007 [3.2K]

Answer:

DNA → mRNA → tRNA → Protein

DNA → mRNA → tRNA → Protein

Explanation:

This is because during protein synthesis, DNA is use to make RNA in the process called transcription. The DNA double strand is unwind by an enzyme called RNA polymerase to produce mRNA in the nucleus. The trans is produced in the nucleolus by RNA polymerase 1 and the site then binds aminoacyl tRNAs which is assembled in the RIBOSOMES. The tRNA are then translated into protein.

8 0
2 years ago
Other questions:
  • In humans, the allele for brown eyes is dominant to the allele for blue eyes. If a man with blue eyes and a woman with brown eye
    9·2 answers
  • All individuals have two alleles for a given trait. According to Mendel's ____________, these alleles are passed down one each f
    11·2 answers
  • how do marine scientist work to balance protection of the environment with the need to extract resources from the ocean
    13·1 answer
  • What is meant by the statement "Evolution may proceed along 'genetic lines of least resistance'"?
    9·1 answer
  • Pls help asap
    13·1 answer
  • Describe compact bone
    9·2 answers
  • Telomerase is an enzyme that is produced only in cells that are actively dividing. For this reason it is generally absent from b
    11·1 answer
  • Which term best describes the organic molecule below?
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following tools was responsible for advancing our knowledge of cells over the past 400 years?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!