1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
8

Alex has 48 stickers. This is 6 times the number of stickers Max has. How many stickers does Alex have?

Mathematics
2 answers:
Serjik [45]3 years ago
8 0
Alex would still have 48 stickers, but if youre looking for the amount of stickers max has it would be 8 because 48 divided by 6 is 8
lbvjy [14]3 years ago
5 0
Alex still has 48 stickers. 
You might be interested in
I need help in this problem
ArbitrLikvidat [17]
The equation is saying that -3x+10=5x-8. Once you get all the same terms on one side, you get 18=8x. That would end up being a decimal number, instead of a whole number. The x values would either have to be -4x or 6x in order to make the problem equal
5 0
3 years ago
Mitchell use one fourth of a carton of 12 eggs to make an omelette how many eggs did she use
Leto [7]
3 Eggs: 4 times what equals 12? (We use 4 because its 1/4 or a quarter) 3 times 4 equals 12.
6 0
3 years ago
Read 2 more answers
What is 1997 from 2014????????????
katen-ka-za [31]
What? That doesn't make sence! Any way if you mean 1997 to 2014 how many years.
3 0
3 years ago
Read 2 more answers
Evaluate the expression 5(8y+3r-5z) if r=3,y=5/8,and z=2
snow_lady [41]
First you plug in the missing values
5(8×5/8+3×3-5×2) = 20
3 0
3 years ago
What are the roots of the polynomial equation x^3-5x+5=2x^2-5? Use a graphing calculator and a system of equations. Round nonint
leonid [27]

The right answer is c. –2.24, 2, 2.24


This question needs to be solved in two ways. First, using a graphing calculator. Next, using a system of equations.


1. Using a graphing calculator.


We have the following polynomial equation:

x^3-5x+5=2x^2-5


By ordering this equation we have:

x^3-2x^2-5x+10=0


So, we can say that this equation comes from a function given by:

f(x)=x^3-2x^2-5x+10


Thus, by plotting this function, we have that the graph of this function is indicated in Figure 1. By zooming, we can see, in Figure 2, that the roots of the polynomial equation are the x-intercepts of f(x) which are:


x_{1}=-2.236 \\ \\ x_{2}=2 \\ \\ x_{3}=2.236


Finally, rounding noninteger roots to the nearest hundredth we have:


\boxed{Root_{1}=-2.24} \\ \\ \boxed{Root_{2}=2} \\ \\ \boxed{Root_{3}=2.24}


2. Using a system of equations.


The ordered equation is:

x^3-2x^2-5x+10=0


By arranging to factor out we have:

x^3-5x-2x^2+10=0


Then, by factoring:

x(x^2-5)-2(x^2-5)=0


Term (x^2-5) is a common factor, thus:


(x-2)(x^2-5)=0 \\ \\ (x-2)(x-\sqrt{5})(x+\sqrt{5})=0 \\ \\ Finally: \\ \\ \boxed{Root_{1}=-\sqrt{5}=-2.24} \\ \\ \boxed{Root_{2}=2} \\ \\ \boxed{Root_{3}=\sqrt{5}=2.24}

6 0
3 years ago
Read 2 more answers
Other questions:
  • A plumber charges a one-time service fee of $20 in addition to his hourly
    10·1 answer
  • Formula for the area of a circle in terms of its circumference
    8·1 answer
  • the distance between earth and the moon is about 238,900 miles. round this number to the nearest ten thousand
    6·1 answer
  • Ссппер<br> What is the image of (7, -2) after a reflection over the line y = -x?
    14·1 answer
  • Zack needs $299.99 to buy the new bike he wants. He has saved $150 so far toward the new bike. From this week on, he will save $
    11·2 answers
  • Which of the equations shown have infinitely many solutions?
    15·2 answers
  • Please help i need help with number 4 and 5
    6·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the value of p in the equation p−18=38??
    10·1 answer
  • Reba got home from school at 2:55 P.M. and played video games for 1 hour and 20 minutes. Then, it took her 1 hour and 35 minutes
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!