1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
7

Do u know this answer

Biology
1 answer:
Vanyuwa [196]3 years ago
6 0
I believe it is D, you are correct
You might be interested in
What orgenell has a wip like tail that moves<br> the cell
Paraphin [41]

Answer: flagella

Explanation: not sure but i believe it is

8 0
3 years ago
Read 2 more answers
chromosomes, which contain DNA, have serval functions. All BUT ONE of these statesmen’s is a function of chromosome
ludmilkaskok [199]

Chromosomes, which contain DNA, have several functions. All BUT ONE of these statements is a function of chromosomes. A) Chromosomes determine the traits of an organism. B) Chromosomes provide instructions to make proteins.

4 0
4 years ago
Read 2 more answers
Energy converting organelle found in plant and algae cells are called ___
Murrr4er [49]

the pigmint called chloroplast

5 0
3 years ago
HELp I will mark brainlyest if correct
tino4ka555 [31]
1. bababooey
2. Based
Those are the answers
7 0
3 years ago
Read 2 more answers
The position of the interventricular septum is deep to the ______ located on the heart's superficial surface.
amid [387]

Answer:

interventricular septum

Explanation:

Quizlet

4 0
2 years ago
Other questions:
  • What are the implications of a toxic extremophile that is infected with a lethal virus?
    7·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which type of mutation adds one or more base pairs?
    14·1 answer
  • What in-group biases do you see around you? Explain
    15·1 answer
  • Put genes for
    13·2 answers
  • Life took about 3.2- 3.7 billion years to reach its present level of complexity. To maintain it, life must always come from life
    13·2 answers
  • What is the relationship between activity level and heart rate?
    15·1 answer
  • Which element has fewer than four dots in its electron dot diagrams?
    11·1 answer
  • As a result of mitosis, the cells of a multicellular organism share which of these properties? Select two correct answers.
    9·1 answer
  • What describes the genetic orders such as alkaptonuria and albinism.<br><br><br><br><br>​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!