A meander forms when moving water in a stream erodes the outer banks and widens its valley, and the inner part of the river has less energy and deposits silt. A stream of any volume may assume a meandering course, alternately eroding sediments from the outside of a bend and depositing them on the inside.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
Answer:
I'd need the data from the population sizes of the algae, walleye pollock, orca, ocean sunfish and sea turtles. And I'd also need water temperature data, levels of dissolved oxygen.
Explanation:
The jellyfish population may have increased because of an increase in phytoplankton. This leads to an increase in
zooplankton; a decrease in walleye pollock, leading to an increase in zooplankton; or an increase in orcas, leading to a
decrease in sea turtles. Sea turtles, being the main predator for keeping the jellyfish population in check.
Also, if there are more red algae, jellyfish polyps have less place to grow. Without it, the polyps can attach itself on every surface.
Answer:Precipitation, evaporation, freezing and melting and condensation are all part of the hydrological cycle - a never-ending global process of water circulation from clouds to land, to the ocean, and back to the clouds.
Explanation:
