1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UkoKoshka [18]
3 years ago
6

During the systole phase of the cardiac cycle, the left ventricle contracts and blood is pumped into the aorta. Which of these v

alves prevents a backflow of blood into the left atrium?
A. aortic valve
B. tricuspid valve
C. mitral valve
Biology
2 answers:
Lady bird [3.3K]3 years ago
7 0
<span>MITRAL VALVE

Location: Between the left atrium and left ventricle

Function: Prevents backflow of blood to the left atrium when the left ventricle contracts</span>
Lapatulllka [165]3 years ago
7 0

The correct answer is C. MITRAL VALVE

You might be interested in
Give an example of a direct and indirect interaction between two organisms
horsena [70]

Answer:

The example of direct interaction between two organisms is in coral reefs some fishes behave as a cleaner for the other fish.

Explanation:

The fish eats the parasites which harms the other fish. In this the cleaner fish gets food and the other fish gets rid of parasites. The example of indirect interaction between two organisms is when the birds eat the caterpillar, there is a positive impact on the plants because the Caterpillars used to the leaf of the plants.

The direct interaction between two organisms is defined as when the action of one organism has a direct impact on the other organism. The indirect interaction between two organisms is defined as when the action of one organism is responsible for indirect impact on the other organism.  

3 0
3 years ago
The mitochondrion of a cell
Iteru [2.4K]

Answer: Option D) is where cellular respiration occurs.

Explanation:

The mitochondria of the cell is a double-membraned organelle and serve as a site of respiration in plant and animal cells.

Thus, the generation of energy in form of ATP molecules occur within the inner membrane of the mitochondria.

8 0
3 years ago
Dasfgahggjhgfjhgkjhkjhkjhk
Inessa05 [86]

Answer:

what's this bae ? Thanks!❤︎ت︎

3 0
3 years ago
Read 2 more answers
•
rewona [7]

Answer:

who are you ? hit you hell

8 0
3 years ago
Read 2 more answers
Where on Earth can you find collision zones?
sergiy2304 [10]

Answer:

You can find collision zones on the edge of the Pacific Ocean offshore Washington, Canada, Alaska, Russa, Japan, and Indonisa.

Explanation:

6 0
3 years ago
Other questions:
  • How is information for a specific protein carried on the dna molecule
    12·1 answer
  • Why is homeostasis important for survival
    7·1 answer
  • By the end of the preschool period, the brain structure called the __________ becomes considerably thicker, with individual fibe
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following instruments produces highly magnified images of a cell’s internal structure but cannot be used to examine
    13·1 answer
  • How can you overcome the inertia of an object?
    10·2 answers
  • Fact, fiction, or opinion.
    7·2 answers
  • Before mitosis begins, what happens during S-phase?
    14·1 answer
  • Which organism can convert light energy into chemical energy?
    9·1 answer
  • What type of muscle action would expend the highest amount of energy at a fixed resistance level over a comparable duration?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!