It selectively controls what goes in and out of the cell
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
<h3>Answer:</h3>
Convection currents in the mantle
<h3>Explanation:</h3>
Our current laws of Physics recognize that heat is transferred by one of ...
- conduction
- convection
- radiation.
Radiation is a mechanism for transferring heat through space. That mechanism doesn't really apply inside the "solid" Earth. While a certain amount of heat is transferred by conduction, the rock making up the bulk of the Earth is a poor conductor of heat.
The majority of the heat is transferred by the hot rock physically moving from the center of the earth toward the surface in the process called convection.
The answers would be wind speed, air pressure, and wind direction.
Wind speed and air pressure are necessary to show how fast the windmill is going, and the wind direction is necessary to show which direction the windmill is going.
Answer:
It is a compound sentence.
Explanation:
Compound sentence contains two independent clauses.
