1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DiKsa [7]
3 years ago
7

The graph shows the history of human population growth.

Biology
2 answers:
algol [13]3 years ago
7 0

Answer:

O C. The population's growth rate is increasing exponentially

g100num [7]3 years ago
6 0
O.c population has stopped growing due to one more limiting
You might be interested in
What is the capital of argentina
Greeley [361]

Buenos Aires is the capital of argentina

4 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
How many total, non-unique alleles are there for each gene in a population of 250 humans?
zvonat [6]

Answer:

C

Explanation:

4 0
3 years ago
Read 2 more answers
In what two ways is the krebs cycle important for making atp
ella [17]

Answer:

The krebs cycle produces two ATP and energy carrying molecules that are used to produce more ATP in the electron transport chain.

Explanation:

5 0
3 years ago
A simplified model of the human blood-type system has four blood types: a, b,ab and o. thereare two antigens, anti-a and anti-b.
Kay [80]
First calculate the probability of type AB, which is the remainder after subtracting types A, B and O.

P(AB) = 1-(0.34+0.12+0.5) = 1-0.96 = 0.04

Anti-b will react with types B and AB, so 
P(reaction) = P(B)+P(AB) = 0.12 +  0.04 = 0.16

Answer: For this person, the probability of reaction with anti-b is 0.16
8 0
3 years ago
Other questions:
  • The process by which cells reproduce is a. diffusion b. osmosis c.cell division d.respiration.
    8·2 answers
  • The weather instrument that works on facts that air on motion is?​
    7·1 answer
  • How does an echinoderm use its tube feet
    10·1 answer
  • Translation is divided into three phases: initiation, elongation, and termination. In this tutorial you will gain an understandi
    11·1 answer
  • Similarities between the Frog nervous system and the human nervous system
    6·1 answer
  • What is DNA and what is it function
    7·2 answers
  • The order Cetacea includes modern-day whales, dolphins, and porpoises. These marine mammals share common characteristics that ha
    14·1 answer
  • Distinguish between heterochromatin and euchromatin
    7·1 answer
  • Multiple questions I will give you 33 points so help me
    12·1 answer
  • Explain why scientists have classified protists in one kingdom when they are such a diverse group.​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!