1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondaur [170]
3 years ago
7

How does the temperature of earth's crust compare to the temperature of earth's interior?

Biology
1 answer:
maxonik [38]3 years ago
3 0
The temperature of the crust is much cooler than the interior.
Hope this helped :)
You might be interested in
What occurs during the mitosis stage of the cell cycle?
Dennis_Churaev [7]

Answer:

The dna Seprates into two

Explanation:

also the cytoplasm divdes causing it to create two whole new cells

6 0
2 years ago
What are the finger-like extensions in this part that actually absorbs the nutrients?
Lera25 [3.4K]

Answer:

Villi

Explanation:

Hope this helps have a good day :)

3 0
2 years ago
The symptoms of a lung-expansion injury tend to appear _____ while the symptoms of decompression sickness tend to appear ______.
Margarita [4]

The symptoms of a lung-expansion injury tend to appear immediately after the dive while the symptoms of decompression sickness tend to appear usually slower after the dive.

Why does oxygen treat scuba-related illnesses?

Decompression sickness (DCS) patients address the disease process by dissolving air bubbles in the blood and tissues and diffusing excess nitrogen to oxygenate ischemic regions.

Needs to be recompressed Recompression was traditionally carried out with the assistance of a personal doctor or technician and a customized chamber that allowed for a controlled rise in atmospheric pressure. DCS divers have to travel further to decompression rooms since the number of rooms accessible for 24-hour emergency care countrywide is decreasing at an alarming rate.

To learn more about DCS visit the link:

brainly.com/question/28233311?referrer=searchResults

#SPJ4

8 0
2 years ago
Like mammals, dolphins breathe air, but they are born underwater. Which is an innate behavior that a dolphin uses to breathe for
yan [13]
The answer is B.  This is because baby dolphins, when born, can't really comprehend a lot of things yet, so they, and the more adult dolphins there, try to get to the surface of the ocean to take a breath.  :D  I hope I helped!
4 0
3 years ago
Characterization and determination of the S/G ratio via Py-GC/MS of agricultural and industrial residues
Oksanka [162]

Characterization and determination of the S/G ratio via Py-GC/MS of agricultural and industrial residues.

<h3>What is the abstract?</h3>

To investigate the potential lignin values, agricultural residues (apple tree pruning, olive tree pruning, and almond shell) and industrial residues (kraft black liquor) were employed as source materials for lignin extraction via various fractionation procedures (kraft, organosolv, acetosolv and acetosolv and formosolv processes). Py-GC/MS, FTIR, and GPC were used to characterise the separated lignins. The fractionation method had a significant impact on the average molecular weight (Mw) assessed by GPC. The severe circumstances of the acetosolv and acetosolv-formosolv procedures favoured repolymerization, resulting in high Mw lignins. Because of the longer retention durations, the EKL had a smaller Mw. Except for almond shell lignin, which has the highest relative abundance of G-type phenols, all lignins have higher relative abundances of S-type phenols.

To learn more about phenols visit:

brainly.com/question/19131807

#SPJ4

5 0
1 year ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Explain the apparent contradictions in defining microbiology as the study of microscopic organisms or the study of single-celled
    5·1 answer
  • Which membranous organelle is found next to the nucleus and is covered in ribosomes?
    15·2 answers
  • Can most organisms that live in the littoral zone could also live in an intertidal area?Why or why not?
    14·1 answer
  • What does the independent variable mean
    11·2 answers
  • What is the branching network of filaments of a fungus called?
    14·1 answer
  • What are examples of chemical changes?
    6·2 answers
  • Hemoglobin is a protein that all red blood cells need to carry oxygen. It is made by cells called erythrocytes in the bone marro
    12·1 answer
  • If you do not have an adequate level of fat in your body, you might have trouble
    13·1 answer
  • Please look in comments because question is not posting
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!