1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
3 years ago
8

Which of the following is a major determinant of the distribution pattern of a population?

Biology
1 answer:
horrorfan [7]3 years ago
3 0

Answer:

a.) rate of population growth

Explanation:

The population growth rate determines how a population will be distributed in a region. Populations with a high growth rate need to occupy more spaces, in addition to needing to consume a greater volume of natural resources. As the population grows, the distribution in the region becomes more intense, the opposite also happens. When the population growth rate indicates that the population is decreasing it means that this population will need less space and therefore, its geographic distribution will be smaller, as well as its impact on the region.

You might be interested in
Who is sonu sharma in india​
larisa [96]

Sonu Sharma is the founder of DYNAMIC INDIA GROUP (INDIA). An Author, Educator, Business Consultant and a successful Entrepreneur, he is a much sought-after speaker. Today he is one of the Youngest Inspirational Speaker in India.

3 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
PLEASE HELP❤️❤️❤️
Lana71 [14]

Answer:

A. Yes, because molecules move down the

concentration gradient without using energy.

Explanation:

Active transport is the energy-requiring process of pumping molecules and ions across membranes against a concentration gradient. Both endocytosis and exocytosis are active transport processes.

Hope that helps!

6 0
3 years ago
Granite forms when liquid magma slowly cools within the Earth's crust. Basalt can form when lava cools on Earth's surface. What
FinnZ [79.3K]

Answer:

well in some cases granite is not in fact allowed to from bacause many popele said no.

Explanation:

you see here i have no idea waht this is because i m not in this class but  

       

5 0
3 years ago
Read 2 more answers
Which of these processes has a cooling effect on Earth?
Bingel [31]

I believe the answer is B: Earth's oceans absorb some of the carbon dioxide from the atmosphere.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why are compounds different from single elements?
    7·1 answer
  • Nitrogen is made available in a useful form for animals in the A. fertilizers they absorb. B. plants they eat. C. air they breat
    5·1 answer
  • During which phase of meiosis does crossing over occur?
    5·2 answers
  • Which of the following isa disadvantage of a series circuit?
    15·1 answer
  • Help please Biology!!
    5·1 answer
  • which of the following are the factors that both unicellular and multicellular organisms actively balance in the order to achiev
    11·2 answers
  • 17. The mass of the products of a chemical reaction the mass of the reactants.
    9·1 answer
  • Reflection:
    15·1 answer
  • Describing How Traits Are Inherited
    15·1 answer
  • This process can release energy for the cells without using any oxygen
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!