1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
3 years ago
5

What would happen to the proton gradient and ATP production after a drug has poisoned the enzyme that combines acetyl CoA and ox

aloacetate to form citrate?(a)- Less NADH production would create a weaker proton gradient and greater ATP production. (b)-Less NADH production would create a stronger proton gradient and greater ATP production. (c)-Less NADH production would create to a weaker proton gradient and less ATP production. (d)- More NADH production would create a stronger proton gradient and greator ATP production.
Biology
1 answer:
I am Lyosha [343]3 years ago
8 0

Answer:

The best answer to the question: What would happen to the proton gradient and ATP production after a drug has poisoned the enzyme that combines acetyl CoA and oxaloacetate to form citrate? Would be, C: Less NADH production would create to a weaker proton gradient and less ATP production.

Explanation:

The reason comes from remembering that ATP is a molecule that is produced when protons are transferred in a chemical reaction called anabolism to the precursor for ATP, ADP. This process of transference of protons requires the correct work of several chemical compounds, including enzymes and coenzymes, which basically assist enzymes in the management of hydrogen atoms during metabolic processses.

NADH, like others, is a coenzyme whose task is to accept hydrogen atoms and assist in the oxidation-reduction reactions that take place in the body, including the production of ATP. If a poison has stopped the correct transfer of protons by preventing the correct work of both enzymes and coenzymes, then the direct result is the lesser production of NADH and therefore there will be a much less efficient process of proton transfer to produce ATP.

You might be interested in
Scientists believe the inner core of the earth is...
lorasvet [3.4K]
The answer is C. solid iron and nickel
4 0
3 years ago
All of the following characteristics of clouds indicate high speed winds, EXCEPT…
raketka [301]
B) Billowy sheep-like clouds.
4 0
3 years ago
Are living and non living things made of the same ingredients?why or why not?
brilliants [131]

Answer:

they are not made of the same ingredients

Explanation:

All living things breathe, eat, grow, move, reproduce and have senses. Non living things do not eat, grow, breathe, move and reproduce. They do not have senses.

6 0
3 years ago
Most studies indicate that tobacco and marijuana tend to be a. substitutes. b. complements. c. unrelated because one good is leg
koban [17]
<h2>Answer is option "b"</h2><h3>Explanation:</h3>
  • The complement systems are a key natural insusceptible barrier against disease and a significant driver of irritation; in any case, these very properties can likewise cause hurt. Unseemly or uncontrolled initiation of compliment can cause nearby as well as fundamental irritation, tissue harm and ailment.
  • Complement gives various choices to tranquilize advancement as it is a proteolytic course that includes nine explicit proteases, one of a kind multimolecular enactment and lytic edifices, a stockpile of characteristic inhibitors, and various receptors that dilemma to actuation sections.
  • Medication configuration is encouraged by the undeniably itemized basic comprehension of the atoms associated with the complement system. Just two enemies of compliment drugs are as of now available, however, a lot more are being produced for sicknesses that incorporate irresistible, provocative, degenerative, horrible and neoplastic disorders.
  • Hence, the right answer is option b "Complements".\

5 0
4 years ago
Cells can interact by releasing proteins or other molecules as chemical signals. How do cells receive these signals?
____ [38]

Answer: Cells typically receive signals in chemical form via various signaling molecules.

4 0
3 years ago
Other questions:
  • Use the Lander and Waterman application of the Poisson distribution to calculate the number of reads that you need to sequence t
    10·1 answer
  • Is a arctic wolf a decomposer,primary consumer,or a secondary consumer
    15·1 answer
  • "When the genome of a particular species is said to include 20,000 protein-coding regions, what does this imply
    7·1 answer
  • Which two cellular structures work together to synthesize, modify, and transport macromolecules within the cell ? A. Endoplasmic
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Describe the path taken by a carbon atom as it moves from being part of the carbon dioxide in the air to being part of a starch
    7·1 answer
  • Helpppppppppppp pleaseeeeeeww
    9·1 answer
  • How does the environmental change affect the survival of species ?
    13·2 answers
  • QUESTION 1 Genetic information has become part of our culture and it is difficult to tell the difference between unmodified and
    12·1 answer
  • What organelles do plants have in their roots that helps them to sense gravity
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!