Plant cell walls are rigid membranes on the outermost part of the cell. The cell wall provides a structured shape for the cell, helping the cell retain its form and shape. The cell wall also controls the rate of replication, allowing plant cells to replicate at a much slower rate than animal cells.
Answer:
Genes & DNA
Explanation:
Heritable traits are known to be passed from one generation to the next via DNA, a molecule that encodes genetic information.Organisms inherit genetic material from their parents in the form of homologous chromosomes, containing a unique combination of DNA sequences that code for genes.
Answer:
F stands for feather R stands for red and W stands for white.
Explanation:
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
