1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katarina [22]
2 years ago
8

I need help is it A B C or D

Biology
1 answer:
Neko [114]2 years ago
7 0
I think it is C but i am not completely positive.<span />
You might be interested in
Which of the following is a disadvantage of wind as an energy source?
lesya692 [45]

Explanation:

Wind energy is one of the sources of renewable sources of energy that is environmentally friendly.

It uses wind power to generate other forms of energy mostly electricity.

Some of the drawbacks are:

  • Wind turbines pose serious threat to wildlife. It is common place to see dead birds in areas where wind power is being harnessed.
  • The quantity fluctuates from time to time. Since wind is an element of weather, it is not always in regular supply as desired.
  • The cost of constructing wind turbines can be very high a times.

Learn more:

Non-renewable sources of energy brainly.com/question/3386515

#learnwithBrainly

4 0
3 years ago
What is an animal cell?What are the functions of animal cell?​
Yakvenalex [24]

Answer:

A cell carries out all the processes of the body which includes producing energy and storing it, making proteins which are molecules which have roles in metabolism, transportation of other molecules and DNA replication.

6 0
2 years ago
In the biology lab you have just finished a dissection, you should do all of the following EXCEPT: Throw all used slides in the
just olya [345]
A is correct

The slides would have the specimen on it as well
5 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
ATP is a compound that is synthesized when
Reil [10]
ATP, also called adenosine triphosphate or the body's energy currency, is a compound that is synthesized when we have a compound called adenosine diphosphate (ADP). When this compound gets another phosphate group (P) attached, we get the more known ATP. This is also why the name changes from diphosphate to triphosphate (di - two, tri - three). 
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is the best definition of an atom?
    6·2 answers
  • Black fur(b) in guinea pigs is dominant over white fur(b). find the probability of a hybrid offspring in the cross: bb x bb. 0%
    13·2 answers
  • During a science fair, a group of students came up with the following question: "Is color an inherent property in objects or is
    12·2 answers
  • Deer are natural predators for wolves and coyotes true or false
    9·1 answer
  • The concentration of glucose in human blood plasma is maintained at about 5 mM. The concentration of free glucose inside a myocy
    15·1 answer
  • Alpha radiation releases two ____ from the parent nucleus
    6·1 answer
  • Which type of rock can only form on or very near Earth's surface?
    15·2 answers
  • What does the phrase "struggle for existence" mean
    12·2 answers
  • Fertilization is when a sperm and egg fuse together to make a zygote. Once formed, the
    6·1 answer
  • I’ll mark brainliest
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!