1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudiy27
3 years ago
9

Bastrop had a forest fire about 6 years ago. Describe what will the area look like in about 20 years?

Biology
1 answer:
Gre4nikov [31]3 years ago
6 0
Forest fires actually help the environment, they remove plants and trees that are useless and leave space for new plants and trees to grow. After 26 years after the fire, the forest will start to grow again and will be green once again. 

Have a nice day! :)
You might be interested in
Water molecules have a strong attraction to one another.
vampirchik [111]

Answer:

The correct answer is B: Cohesion

Explanation:

<u>Cohesion</u> is the ability of water molecules to be strongly bonded together. This happens due to the polarity of water molecules. Since water is made up of two positive hydrogen ions that combine with one negative oxygen ion to form a hydrogen bond. Hence, the molecular structure of water enables hydrogen irons to attract oxygen ions that create a strong polar bond between water molecules.

8 0
3 years ago
Read 2 more answers
Compare bacteria to other single-celled organisms. How do they differ? How do they compare to viruses?
Vlada [557]
Bacteria<span> are single-celled, </span>prokaryotic<span> microorganisms that exist in abundance in both living hosts and in all areas of the planet. 

</span>
4 0
3 years ago
An aquifer has been compared to a sponge. Think about this analogy for a moment explain why the use of the word quotations “spon
wariber [46]

The word sponge is more appropriate to use than Underground river since an underground river can loose water while an aquifer cannot loose water, unless it is open-air and above ground. then the aquifer would slowly loose water due to evaporation from the sun.

7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Uh if someone can do the rest of this they get brain<br>nliest and 30 points
Lerok [7]

Answer:

do it yourself.

Explanation:

Do it yourself

6 0
3 years ago
Read 2 more answers
Other questions:
  • During what process in the cell cycle does one cell become two cells?
    7·2 answers
  • The role of the ribosome is to help mRNA and tRNA interact. It is made of to subunits and is roughly half ____ and protein
    7·1 answer
  • What ultimately happens to the light energy captured during photosynthesis?
    5·1 answer
  • What atoms are present in each type of molecule
    9·1 answer
  • Why was an algae cell included along with the plant and animal cells?
    13·2 answers
  • Explain the relationship of inheritance, mutations, and common ancestry.
    14·1 answer
  • This process of protein synthesis occurs similarly in most organisms due to the fact that it is the same universal ____ molecule
    15·2 answers
  • PLESE HELP IM GONNA FAIL WILL GIVE BRAINLESS
    11·1 answer
  • Two of the uncontrollable risk factors of cardiovascular disease are weight and age.
    11·1 answer
  • Alcohol is not considered a ________ because it does not support the regulation of body functions or tissue repair or rebuilding
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!