1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
3 years ago
5

How many species of organisms are estimated to inhabit the Earth

Biology
2 answers:
tatiyna3 years ago
6 0

Answer:

8.7 million

Explanation:

About 8.7 million (give or take 1.3 million) is the new, estimated total number of species on Earth -- the most precise calculation ever offered -- with 6.5 million species on land and 2.2 million in oceans.

timofeeve [1]3 years ago
4 0

Answer:

8.7 million

Explanation:

its the estimated value there isn't much more to explain

You might be interested in
Ringing in the ears is called:
Elza [17]

Answer:

c. tinnitus

Explanation:

Tinnitus (a hearing impairment) is a form of  hearing of sound when no external sound is present Which is often described as a Ringing,Tinnitus may also sound like a clicking or roaring. i.e usually unclear voices or music are heard. The sound may be soft or loud, low or high pitched, and appear to be coming from one or both ears. Ranging from one person to another, the sound may causes depression or anxiety and can interfere with concentration.

Otitis externa is a condition that causes inflammation , the inflammation also covers  (redness and swelling) of the external ear canal, i.e the tube between the outer ear and eardrum.

Meniere's disease popularly called (MD), is a disorder of the inner ear that is characterized by episodes of feeling like the world is spinning (vertigo), hearing loss, and a fullness in the  ear. The cause of MD involves both genetic and environmental factors. Some of the factors include constrictions in blood vessels, viral infections, and autoimmune reactions.

Otosclerosis is a condition where one or more foci of irregularly laid spongy bone replace part of normally dense enchondral layer of bony otic capsule in the bony labyrinth. This condition affects one of the ossicles (the stapes) resulting in hearing loss, vertigo or a combination of symptoms.

Therefore from the foregoing we can conclude that Tinnitus is the correct anwser.

4 0
3 years ago
Read 2 more answers
What did the Clean Air Act allow citizens to do that no previous U.S. environmental law had allowed?
OlgaM077 [116]

Answer:

The correct answer to the question: What did the Clean Air Act allow citizens to do that no previous U.S. environmental law had allowed, would be: it was the first law that considered citizen lawsuits against the correct enforcement of the statutes stated in the Act.

Explanation:

The Clean Air Act, which was passed originally in 1963, and which has been amended since, with its last update being in the 1990´s, became the first time that the U.S government not only established federal funding for environmental issues, but also regulated environmental topics through EPA (Environmental Protection Agency, 1970) and considered the power that citizens could have to ensure the enforcement of the statutes and provisions considered in the Act. This consideration of citizen suits, is the most important  and relevant difference with earlier environmental laws.

4 0
3 years ago
How are plant cells and cheek cells similar?
Yuri [45]
They both contain nucleus.
6 0
3 years ago
The Krebs cycle sustains itself as long as ___________ & ____________ are present
Nookie1986 [14]

Answer:

Oxygen and pyruvate.

Explanation:

The krebs cycle is a stage of cellular respiration and occurs in aerobic organisms. In this case, we can say that the Krebs Cycle only occurs in the presence of oxygen, being essential for the completion of cell respiration.

The Krebs cycle only occurs after the completion of glycolysis, as it needs to be initiated by pyruvate, which is a molecule resulting from glycolysis. In this case, in addition to oxygen, the presence of pyruvate is essential for the krebs cycle to occur.

7 0
3 years ago
Four critical nutrients essential to sustain living organisms are?
Sophie [7]

Answer:

carbohydrates, proteins, fats, vitamins, and minerals

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • True statements about fungi
    15·2 answers
  • What is the hardy weinberg symbol for the dominant allele
    6·1 answer
  • What is one purpose of a data table
    10·1 answer
  • During photosynthesis, plant leaves take in carbon dioxide through what in their leaves?
    6·1 answer
  • What’s the answer to this question?
    7·1 answer
  • Human activity can contaminate water resources by introducing excess ____, such as nitrogen and phosphorous found in______ and h
    9·1 answer
  • ​Which cellular component is common to all cell types?
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Water power is a clean and renewable source of energy, but has many drawbacks. Which of the statement describes how hydropower d
    6·2 answers
  • Which statement best describes how a cell-membrane helps a cell remove waist?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!