1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
10

Does protozoa require a host for reproduction? Yes No

Biology
1 answer:
Kipish [7]3 years ago
8 0

Yes,  Protozoa and Prions require a host cell for reproduction.

You might be interested in
Help me please, I still have 23 more questions to answer.
marshall27 [118]

Answer:

C

Explanation:

4 0
2 years ago
Read 2 more answers
Is immunity a function of proteins
Mrrafil [7]

Answer:

Yes

Explanation:

Of the many functions of protein in your body, one of its most critical is supporting your immune system. The immune response protects you against harmful microorganisms, including viruses and bacteria, as well as foreign substances that might attack your defenses, such as a thorn or flames from a fire.

3 0
2 years ago
Which of the following change and sea surface temperature best describes a La Niña event?
ivanzaharov [21]
La Niña follows after an El Niño. Its sea surface temperature will be lower than the natural one by 3-5 degree Celcius which tells us that it is cooler than the average temperature. It is the positive state of the El Niño. It really disturbs the natural weather patterns which could result to extreme storms.
3 0
3 years ago
The cholera toxin, an AB exotoxin, attaches an ADP-ribose group to the host's stimulatory G factor (Gs). The normal function of
SCORPION-xisa [38]
<h2>b) option is correct </h2>

Explanation:

  • Some bacterial toxins cause disease by  altering the activity of G protein, cholera toxin is one of them
  • Cholera toxin catalyse ADP ribosylation of Gs and blocks GTPase activity thus Gs GTP become permanently active
  • Constitutive activation of Gs protein continuously induce adenylyl cyclase, cytosolic cAMP level rises that leads to activation of protein kinase A (pKA)
  • Activated pKA catalyse phosphorylation of two transmembrane proteins of intestinal epithelial cells:
  • CFTR cause excessive outflow of Cl- ion and Na+ H+ exchange cause efflux of Na+ ion, both enters in gut and form Na+ Cl-
  • Na+Cl- leads to outflow of water from the gut, resulting in diarrhea and dehydration and this condition may cause death of organisms due to loss of water and ions  
6 0
2 years ago
What is the aswer for the photo
Margarita [4]
This works because the white pain acts as a barrier, therefor the sunlight a bounces off the glass instead of just going through.
8 0
3 years ago
Other questions:
  • Which CNS neuroglial cells remove cell debris, wastes, and pathogens by phagocytosis?
    6·1 answer
  • Snakes, dogs, and humans have a vertebral column. Snakes and dogs have tails, and humans have vestigial tailbones. Dogs and huma
    10·1 answer
  • Ellis-van Creveld syndrome is a form of dwarfism that is inherited in an autosomal recessive pattern. This particular form of dw
    11·1 answer
  • Describe the chemical structure of a cell membrane
    7·1 answer
  • If you wanted to increase the rate of photosynthesis in a plant, you would develop a plant with which of the following character
    5·2 answers
  • The main symptoms of the HIV-AIDS infection are due to the fact that patient’s body can no longer fight off many minor infection
    9·1 answer
  • What are the products of photosynthesis
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How do tulips reproduce?asexually or sexually?
    14·2 answers
  • A deficiency of which amine is responsible for the signs and symptoms of parkinson's disease?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!