1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valina [46]
3 years ago
5

Match the sphere with its correct statement.

Biology
2 answers:
NISA [10]3 years ago
8 0
Lithosphere: rocks and minerals
Hydrosphere :different forms of water
Atmosphere: oxygen and gases
Cryosphere: Ice
Biosphere: plants, animals and humans
Elden [556K]3 years ago
4 0

lithosphere-rocks and minerals

Hydrosphere-different forms of water

Atmosphere-oxygen and gases

Cryosphere-Ice

Biosphere-plants, animals and humans

You might be interested in
How does an enzyme, acting as a biological catalyst, affect activation energy? So my teacher told us in the question that enzyme
bixtya [17]

Answer:

You can say:

Enzymes are soluble.

Enzymes are proteinous in nature.

Enzymes are sensitive to temperature.

Enzymes are sensitive to the activity or alkalinity of their environment.

Enzymes can br inactivated by inhibitors.

5 0
3 years ago
Which statement is true regarding DNA?
Kay [80]

Answer:

A

Explanation:

The true statement regarding DNA is A) contains deoxyribose sugar. DNA (deoxyribonucleic acid) consists of two strands of nucleotides joined by hydrogen bonds. Each nucleotide contains nucleobase (adenine, thymine, cytosine, and guanine), a sugar deoxyribose, and a phosphate group

3 0
3 years ago
Read 2 more answers
Which of these organisms is a part of the group that produces all of the available energy in a food web
shusha [124]

the best organism for that would be grass because it collects water and sun energy and shares the energy with other organisms.

hope this helps you good luck.!!!!

4 0
3 years ago
What type of joints make up the skull?
Yanka [14]

Answer:

The bones of the skull are highly irregular. Most of the bones of the skull are held together by firm, immovable fibrous joints called sutures or synarthroses. These joints allow the developing skull to grow both pre- and postnatally.

Explanation:

6 0
3 years ago
Read 2 more answers
Waters high heat protects organisms in ocean from what
Alja [10]

Answer:

Water's high specific heat allows it to absorb a large amount of heat without changing much in temperature, keeping a relatively constant temperature in oceans and lakes which is beneficial to marine life. If water did not have a high specific heat, then it would increase in temperature very quickly and oceans and lakes would have drastic changes in temperature in very short periods of time. This could harm or kill the organisms living in them.

<h3>hope this was helpful :)</h3>

5 0
3 years ago
Other questions:
  • Choose all the answers that apply.
    9·1 answer
  • What is the difference between goodness of fit and personality conflict?
    12·2 answers
  • the chloroplast, a tiny body within plant cells, is the power generator for life on earth true or false
    7·2 answers
  • The phenotype of an organism ?
    5·2 answers
  • Describe the benefits to using tissue cultures to study medications used for treating cancer cells.
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How does geoscience processes and current human activities affect resources in a swamp?
    7·1 answer
  • Offline, create a complete pictogram that represents (1) the various sources of energy; (2) the percentage of global consumption
    11·1 answer
  • El oxido de cloro (cio), que tiene un efecto importante en la disminucion de la capa de ozono, se descompone rapida mente a temp
    9·1 answer
  • How can scientific conclusions be reliable, but also able to be changed with the introduction of new evidence
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!