1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
14

Which segment of an mrna transcript is removed?

Biology
1 answer:
KengaRu [80]3 years ago
6 0
Introns which are not expressed.
You might be interested in
The churning air in the troposphere helps determine the ___ of a place
babunello [35]
Altitude of the place.
8 0
3 years ago
Ruth is presenting the feedback model to her class help her complete the statements
Rudik [331]

Answer:

Feedback models are tools that provides specific, concise, and clear feedback for a particular thing.

Explanation:

Feedback models are tools that provides specific, concise, and clear feedback for the organization so that an organization can make useful changes which is necessary for the organization growth and development. There is high need of this feedback model which helps us to know about the specific areas where one needs to improve performances in order to work more effectively.

5 0
3 years ago
Energy requires a balanced diet, physical activity, adequate sleep, satisfying work and opportunities for positive interaction.
Makovka662 [10]

Answer: 1. True

2. Between six and right hours

Explanation:

1. Energy simply refers to the ability to do work. It's the strength that's required to be able to sustain a mental or physical activity.

It should be noted that fir positive interaction, energy requires physical activity, a balanced diet, adequate sleep, satisfying work and opportunities. Therefore, the statement is true.

2. Even though the hours of sleep that's used by people typically varies, adults generally need about six to eight hours of sleep.

6 0
2 years ago
If we know what type of rock we are examining, we can figure out
Marysya12 [62]
How it was formed is the answer
4 0
3 years ago
Austin made the claim that meiosis provides an advantage for sexually reproducing organisms by ensuring genetic variation
Mkey [24]

Answer: C. meiosis produces sex cells that are joined during sexual reproduction to produce offspring

Explanation:

Meiosis is also called as reduction division in this the parent diploid cell divides twice to produce four haploid daughter cells. The daughter cells so produce after cell division contain half the number of chromosomes then that of the parent cells. The germ cells in males and females divide twice or meiotic division occurs in them twice to produce four daughter haploid gamete cells that are sperms (male) and ovum (oocyte) (female). These male and female gametes fuse during sexual reproduction. The sperm fertilizes an ovum to produce zygote.

3 0
2 years ago
Other questions:
  • Which of the following is the most important process specific to land dwelling plants
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Select the point of differentiation between the sporozoites and merozoites
    6·2 answers
  • Enzymes can be denatuerd (damaged ) by what environmental factors
    6·1 answer
  • A male walrus lives to be 20 years old and mates with 18 females during its life. A second male lives to be 10 years old but mat
    13·1 answer
  • Central temperature receptors that monitor the body's internal temperature are located within which structure of the brain? A: h
    11·1 answer
  • If both the glomerular and capsular hydrostatic pressures remain unchanged, an increase in the blood colloid osmotic pressure re
    13·1 answer
  • What is the importance of the mitochondria structure in cellular respiration
    12·1 answer
  • Antidiuretic hormone (ADH) and the renin-angiotensin-aldosterone system (RAAS) work together in maintaining osmoregulatory homeo
    6·1 answer
  • Can explain how to do that
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!