1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alekssandra [29.7K]
4 years ago
5

What is the single factor tested in an experiment

Biology
1 answer:
gladu [14]4 years ago
8 0
It is the independent variable
You might be interested in
The amount of time that has passed since two species last shared a common ancestor: cannot be determined, due to gaps in the fos
Anni [7]

Answer:

is revealed by the degree of similarity in sections of their DNA

Explanation:

phylogenetic analysis of DNA sequences of two different species are compared and the level of similarity between nucleotide sequences in DNA help to identify their relatedness.

7 0
4 years ago
I need help!<br><br> What significance does density have for earth?
VladimirAG [237]

Answer:

The atmosphere and Earth's interior are layered by density. Gravity pulls more strongly on denser materials so denser materials are at the center of things. Earth's core, at its center, is denser than its crust. The lowest layer of the atmosphere is denser than the upper layer.

7 0
3 years ago
How is natural selection important to biomes and organisms??
Dmitriy789 [7]
Natural selection<span> is one of the basic mechanisms of evolution, along with mutation, migration, and genetic drift. </span>Results of these processes is the survival and reproduction of organisms which is best suited for their current environment. Hope this answers the question.
3 0
3 years ago
7. The characteristic of life in which an organism obtains and uses energy is
devlian [24]
C growth and development
5 0
3 years ago
Read 2 more answers
What is considered a growing ovary
sdas [7]

Answer:

Idk

Explanation:

3 0
4 years ago
Other questions:
  • What is the name of the globe wind that blows across the US and which direction does it blow?
    9·1 answer
  • Fossil fuels are normally stored in a reservoir deep in the Earth. The carbon in fossil fuels, including coal and oil, are essen
    11·2 answers
  • Plants make food throught photosynthesis, a chemical reaction. What are the starting substances of the reacton? ​
    5·2 answers
  • Why are the cells in a multicellular organism not all the same?
    5·2 answers
  • -How are the water cycle and the nitrogen cycle similar?
    7·1 answer
  • Plz help:) ❤️❤️❤️ASAP!
    11·1 answer
  • Red/green color blindness in humans is caused by an X-linked recessive allele. If a male who is affected by the condition mates
    7·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • In four to six sentences summarize the geologic timeline and major evolutionary events.
    7·1 answer
  • If a gene is replaced with a heterologous sequence such that the gene is then nonfunctional, what is the result usually called
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!