1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
11

Which of these is an example of how the ocean influences climate?

Biology
1 answer:
fredd [130]3 years ago
4 0
I would say b.) “It causes temperatures near shorelines to be less variable.” When you think of climate, temperature comes to mind. Sorry if this is wrong
You might be interested in
Many toxins and poisons block certain enzymes in the mitochondria. For example, many fruits, including apricots, apples, plums,
enot [183]

Answer:

C. All of the answer choices are correct.

Explanation:

Option A is correct because the reproduction of the cell implies arrangement of chromosomes, making of proteins, organelles, cytokinesis and other cells process that need energy since the mitochondria is not working properly there isn't an appropriate organelle function ( option B).

Option D is correct because ATP is needed for the membrane proteins to undergo active transport. For example the sodium-potassium pump is crucial for the balance of ions. With no energy the protein involved in this process would not work.

8 0
3 years ago
Which of these are components of blood? (Select all that apply.)
asambeis [7]

Answer:

oxygen gas

red blood cells

platelets

Explanation:

» <u>Concepts</u>

Your blood is composed of four main things: <u>red blood cells</u> (that transport <u>oxygen</u>), <u>white blood cells</u>, <u>platelets</u>, and <u>plasma</u>. Red blood cells transports oxygen and takes out CO2, white blood cells fight bacteria and viruses, and platelets clot together to stop bleeding.

<u>Bile</u> is a fluid that is produced by the liver and stored in the gallbladder, so it's not a main component of blood.

7 0
2 years ago
Read 2 more answers
Which of the following is needed in the process of DNA replication?
Lisa [10]
All of the above are needed. Nucleotides are the basic building blocks of new DNA, ATP energy is needed because replication is an active process, and enzymes catalyze the reactions needed to carry it out (e.g. helicase to separate the strands to be replicated, DNA polymerase to build the new strands, and ligase to "glue" the fragments together).
4 0
3 years ago
What does this symbol indicate on a weather map?
Minchanka [31]

Answer:

I think its cold front

Explanation:

8 0
3 years ago
Read 2 more answers
Question 4
lawyer [7]
<h2>Answer:</h2>

The principle is <u>4) Archimedes' principle</u>.

<h2>Explanation:</h2>

Archimedes principle, found by the old Greek mathematician and creator Archimedes, expressing that any object totally or incompletely submerged in a liquid (gas or fluid) very still is followed up on by an upward, power the size of which is equivalent to the heaviness of the liquid dislodged by the body.

The volume of dislodged liquid is identical to the volume of an item completely drenched in a liquid or to that portion of the volume underneath the surface for an article halfway submerged in a fluid. The heaviness of the uprooted bit of the liquid is comparable to the extent of the buoyant force.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Choose the best scientific design to test the question “Which soil type results in the highest yield of tomatoes: clay soil or s
    13·1 answer
  • Why do experiments include control groups?
    5·2 answers
  • process requiring energy for the movement of particles across a cell membrane across against the concentration gradient
    12·2 answers
  • Which of the following is the function of proteins?
    8·2 answers
  • What is the percentage of water in blood?
    8·2 answers
  • ¿Qué pensaban los matemáticos de la escuela de Pitágoras?
    8·1 answer
  • Are all animals that share a food source classified in the same trophic level
    6·2 answers
  • 1.
    11·1 answer
  • Essay help please? Animal systems class
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!