1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
9

If too many chloride ions are built up outside of the cell, with which type of transport is the carrier protein associated???

Biology
2 answers:
Archy [21]3 years ago
7 0

Answer:

<h2>Facilitated diffusion.</h2>

Explanation:

It's also called passive transport, this refers to the process of transporting molecules or ions across a membrane. The passive name is given to it, because for this process chemical energy, like ATP, is not required. That's the difference between active and passive transportation.

Also, ions are only involves in a facilitated diffusion.

Lerok [7]3 years ago
3 0
Ion transport or active transport depending on which situation you have.
You might be interested in
Which statement is true about cell differentiation?
PolarNik [594]
A beacause not everything happens to all cells
7 0
3 years ago
Read 2 more answers
Does species are largest unit of life?​
Mademuasel [1]

Answer:

no. domain is the largest scale of measuring of life

6 0
3 years ago
Read 2 more answers
someone please help me with Part A and B on biology please i really need help will give brainliest ​read hard and rotate phone i
finlep [7]

<em>Hi there, I come in behalf of jcherry99,</em>

So, first question -

This shouldn't be that much of an issue, since we have the text to help us out, but I'll try breaking it up into more simpler words:

The placenta is incide the uterus, where the baby starts forming. As you might already know, babies do not eat while they're inside woman's bellies:

So how do they feed?

They feed throught the umbilical cord.

So why is the placenta there? Why would the baby want anything apart from food?

The placenta, instead of trading food with the baby, regulates temperature, supplies it with nutrients, exchanges gas with the mother (which the mother later exchanges with the environment) and gets rid of waste.

And, food is not everything for a baby that is in the urge of developing complex muscles, bones, etc.

Second "question" -

I do not actually know what I'm supposed to do, since there is no question. But I can tell you this - the information contained in part B is correct:

The amnioic sac provides babies with a liquid which allows him to move freely in the uterus, which is very helpful. But, note that he doesn't start moving randomly, he is always in a fetus or similar-to-fetus position.

Hope it helped,

BioTeacher101

6 0
2 years ago
ZWhat Organelle that conducts respiration for the cell
baherus [9]

Answer:

The organelle that conduct respiration for the cell is MITOCHONDRIA.

Explanation:

The cells of living organisms are made up of different organelles, each of the organelles have specific functions, which they perform. The mitochondria is the cell organelle that is responsible for carrying out respiration in the cells. Respiration involves the breaking down of glucose molecules in order to produce energy in form of ATP. Mitochondria is also called the power house of the cell because of its function of energy production.

8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Which diagnostic test would be ordered by the primary healthcare provider to confirm sarcoidosis? chest x-ray blood test electro
    13·1 answer
  • Which term describes the study of the distribution of genetic traits and the allelic changes that occur within a population? pop
    10·1 answer
  • Vegetation that grows along the floors of tropical and temperate forests is called undergrowth. How is the undergrowth of a trop
    7·2 answers
  • What is shown in the image?
    12·2 answers
  • In liver cells, the inner mitochondrial membranes are about five times the area of the outer mitochondrial membranes. What purpo
    14·2 answers
  • Which neurotransmitter is a major regulator of mood and behavior and can be chemically altered using drugs like Prozac or Zoloft
    9·2 answers
  • What kind(s) of cells can develop from unipotent stem cells?
    11·1 answer
  • In what form is the DNA found when a cell is beginning cell division or is involved in cell division?
    6·1 answer
  • A bacterial isolate from a urine specimen was grown in culture, Gram stained, and then tested for its ability to ferment sugars
    10·1 answer
  • Unlike dna, rna contains _________?<br><br> 1. uracil<br> 2. guanine<br> 3. cytosine<br> 4. adenine
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!