1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kompoz [17]
3 years ago
12

Can you help me please i will give you a branlist and it’s science

Biology
1 answer:
creativ13 [48]3 years ago
4 0
The answer is A because c doesn’t make sense if it’s vibrating wouldn’t we feel or see it?
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which of the following is the best description of the events occuring during anaphase I of meiosis?
mote1985 [20]

Answer:

The best description of the events occurring during Ana-phase I of meiosis:

c. Homologous chromosomes randomly separate and migrate to opposite poles.

Explanation:

Meiosis:

It is such type of cell division that occur in animals, plants resulting in four daughter cells and each of daughter cell have the half number of chromosomes from the parent cell.

  • Anaphase is one of important phases of meiosis. The option a is incorrect as chromosomes go randomly to opposite poles.
  • The option b is incorrect as all of chromosomes inherited from mother and father goes randomly to opposite poles.
  • The option c is correct as it is the true description of anaphase I of meiosis.
  • The option d is incorrect as the sister chromatids don't separate rather they remain joined.

5 0
3 years ago
What would the amino acid this DNA sequence CGA?.
Naily [24]

Answer: mRNA: GCU : alanine

Explanation:

4 0
1 year ago
Most modern forms of transportation are powered by fossil fuels. Carbon dioxide, methane, carbon monoxide, and other gases are r
attashe74 [19]
The correct answer is the last option.

The first option (unable to cause climate change) is incorrect because these gases do effect the atmospheric temperatures by increasing them.
The second option is incorrect because while these gases do cause more water vapor to condense, they result in acid rain (not wetter climates). 
7 0
3 years ago
Read 2 more answers
The scientific attitude of skepticism is based on the belief that
denis-greek [22]

Answer:

Questions, hypotheses, and ideas should be tested against observable evidence.

Explanation:

Skepticism is extremely important, if not fundamental, in all areas of Science. This attitude is based on the belief that all questions, hypotheses, and ideas should be tested against observable evidence. Moreover, it allows scientists to <u>question and think thoroughly about all possibilities behind a phenomenon, instead of just 'believing' any observation or vague and non-supported reason that explains it.</u>

In addition, it allows researchers to investigate all possibilities and test numerous methodologies to be certain and gather enough evidence to explain this certain phenomenon.

6 0
3 years ago
Other questions:
  • In pigs, the allele for a wavy, rough coat (R) is dominant to the allele for a soft, fine coat (r). A rough coat boar and a soft
    5·2 answers
  • In all muscle cells, two kinds of protein filaments slide past each other to shorten the muscle cell and generate force. what br
    8·1 answer
  • Fish meal is better than artificial fertilizers. How could this statement be revised to make it a hypothesis?
    8·1 answer
  • What process is similar to binary fission
    14·1 answer
  • Select all of the answers that apply. Which of the following features are types of folds? anticlines and synclines monoclines ho
    13·1 answer
  • Using the picture below, NAME 2 SPHERES that are interacting, which PART of the picture represents that sphere and EXPLAIN how t
    14·1 answer
  • Which describes the function of a peptide bond?'
    10·1 answer
  • Which process and type ??
    11·1 answer
  • what might happen if two friends are miss handling a firearm with no supervision? Does this have to do with genetics or choice?
    6·2 answers
  • Vision depends on an image to be projected onto the?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!