1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
8

An athlete who uses blood from another person for blood doping runs the risk of contracting a blood-borne disease because

Biology
2 answers:
Veronika [31]3 years ago
6 0
Pathogens can exist in blood and then can be passed the transfusions
Salsk061 [2.6K]3 years ago
4 0

Answer:

pathogens can exist in the blood and be passed on through transfusions

Explanation:

Although the risk of transfusion-transmitted infections today is lower than before, the supply of blood transfusions remains subject to contamination with known and unidentified human pathogens. This can cause these pathogens to be transmitted from one person to another. That is, the risk of infections by blood transfusions has been reduced over the years, but not eliminated.

This indicates that athletes who use someone else's blood for blood doping are at risk of contracting a blood-borne disease because pathogens can exist in the blood and then transfusions can be passed on.

You might be interested in
Enzymes perform which of the following functions within living cells? *
pickupchik [31]

Answer:

Catalyzing Chemical Reactions

Explanation:

8 0
2 years ago
Jjjjjjjjjjjjjjjjjjjjjjk
Setler79 [48]

Answer:

good question the answer is A. lol

Explanation:

7 0
2 years ago
Read 2 more answers
The process that enables cells of the body to burn food and release energy is called
serg [7]

...respiration!

Respiration is the biochemical process in which the cells of an organism obtain energy by combining oxygen and glucose, resulting in the release of carbon dioxide, water, and ATP (the currency of energy in cells). Source: https://study.com/academy/lesson/what-is-respiration-definition-process-equation.html

I hope that helps! :)

4 0
2 years ago
Which words in this quote about personal essays from author Barry Lopez are examples of oxymoron?
iren2701 [21]
The words that are examples of oxymoron is : D. outward-seeking

This words could be considered as oxymoron because it's a figure of speech that contradicts the term that appear in the conjunction

hope this helps
6 0
3 years ago
Read 2 more answers
What is the pair of disaccharides
Aneli [31]
A disaccharide (also called a double sugar or biose[1]) is the sugar formed when two monosaccharides (simple sugars) are joined. Like monosaccharides, disaccharides are soluble in water. Three common examples are sucrose, lactose,[2] and maltose.         


Disaccharides are formed by the condensation reactions of two simple sugar molecules.

5 0
2 years ago
Other questions:
  • Which of the following would NOT be a community? a All the many varieties of dogs in your neighborhood. b none of these c All th
    9·1 answer
  • Which of these is not a virus?
    9·2 answers
  • Which two continents fit together best
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Where are all my fellow gays??
    12·2 answers
  • If a male genotype is Tt and the female genotype is TT, then what are the phenotypic ratios for tall and short corn?
    15·1 answer
  • Which behavior is an instinct?
    8·2 answers
  • How are the spines on a cactus different from the leaves on an oak tree?
    5·2 answers
  • The fish left their habitat for a nicer environment.<br> What the plural noun?
    10·1 answer
  • Can all dogs get pregnant male or female
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!