1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
11

Why are plans considered living organisms?

Biology
1 answer:
liraira [26]3 years ago
7 0
The reason is that they have the characteristics that make them a living organism. Sensitivity, Need for food, Execration, Growth, and movement.
You might be interested in
Tracheostomy refers to a procedure to which part of the body
dusya [7]
Tracheotomy refers to creating an opening in the neck in order to place a tube into a person's windpipe.
4 0
3 years ago
Which of these does NOT occur during meiosis? *
Tamiku [17]

Answer:

production of new gene combination

Explanation:

cause it doesnt occur during meiosis

8 0
3 years ago
Match the tissues to their functions. nervous tissue epithelial tissue muscle tissue connective tissue structural support arrowR
algol13

Answer:

B

Explanation:

The asnwer is B

5 0
3 years ago
Read 2 more answers
What are the roles of mucus? Check all that apply.
kondaur [170]

Answer:

A, C

Explanation:

mucus acts as a barrier! all of the other things mentioned (D and E) are caused by white blood cells.

3 0
3 years ago
Read 2 more answers
When an automotive battery is fully charged,the sulfuric acid and water mixture will have a specific gravity of about
avanturin [10]
When an automotive battery is fully charged, the sulfuric acid and water mixture will have a specific gravity of about 1.3. Specific gravity is actually the difference in the weight of water in comparison to a specific fluid. It is measured by a hydrometer. The amount of charge in the battery is normally measured by the specific gravity of the battery. The specific gravity of water is 1 and anything less than one is considered less dense while anything that has a specific gravity of more than 1 is considered more dense than water.


6 0
3 years ago
Read 2 more answers
Other questions:
  • Some types of aquatic frogs
    13·1 answer
  • What is the structural unit of compact bone ?
    14·2 answers
  • Sometimes folding causes layers to what
    11·1 answer
  • What factor may influence enzyme activity?
    5·1 answer
  • The process of digesting your last snack or meal or the unconscious regulation of your breathing are all primarily rooted in the
    12·2 answers
  • Given the DNA strand GAATTCCTCGAG, what would be the complimentary strand to make the double stranded DNA? How do you get the an
    5·1 answer
  • Brown eyes in humans are dominant to blue eyes. A brown-eyed man, whose mother was blue-eyed, marries a brown-eyed woman whose f
    10·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • When blood flows through the body (?). diffuse into the cells and (?) diffuse out.
    10·2 answers
  • Which one of the following conditions would allow gene frequencies to change by chance? small populations gene flow large popula
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!