1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
7

What do you call someone that grows plants?

Biology
2 answers:
e-lub [12.9K]3 years ago
5 0
You call them a gardener
defon3 years ago
4 0
Botanist? Florist? Not sure
You might be interested in
Can you answer this?​
Viefleur [7K]
1 Down: Aorta
2 Down: Blood
3 Across: Circulatory
3 Down: Capillaries
4 Down: Oxygen
5 Across: Systemic
6 Across: Ventricles
6 Down: Valves
7 Across: Heart
8 Across: Veins

I hope this helps! Please give brainliest and thanks if you can
6 0
3 years ago
Explain transformation in DNA
velikii [3]
Plasmid or vector transformation is the process by which exogenous DNA is transferred into the host cell. Transformation usually implies uptake of DNA into bacterial, yeast or plant cells, while transfection is a term usually reserved for mammalian cells.
6 0
3 years ago
2. Fill in the chart on the three types of RNA.
Inessa05 [86]

Answer:

Function:

mRNA: mRNA can be described serves intermediate molecule between the genetic material and the amino acids for the making of protein.

rRNA: It makes up the ribosomes along with the ribosomal proteins. Ribosomes are the sites where the process of translation occurs.

tRNA: The tRNA is involved in the bringing of the nucleotides to the ribososmes for translation.

7 0
3 years ago
A split-brain patient sees something in her left visual field, and must reach behind a screen and select the object from a group
choli [55]

A split-brain patient sees something in her left visual field and must go after a screen and choose the object from a group of objects. she will choose the object perfectly with her left hand.

<h3>What can a split-brain patient do if they see something in the left visual field?</h3>

The fact that split-brain patients can only accurately respond to stimuli in the left visual field with their left hand and to stimuli in the right visual field with their right hand and vocally is another important component of the conventional view.

Patients with split brains can still walk, swim, and ride a bike, which are motor abilities that need both sides of the body and were taught before the onset of their disorder. They can also pick up new skills that require them to move their fingers or hands in parallel or mirror images.

A split-brain patient must reach behind a screen and choose the object from a collection after spotting it in her left visual field. She will use her left hand to make the proper selection of the item.

To learn more about split-brain patient refer to:

brainly.com/question/24879413

#SPJ4

5 0
2 years ago
A nonnative species of beetle is introduced into a woodland ecosystem.
weeeeeb [17]

Answer:

B. Native beetle species outcompete the nonnative species.

Explanation:

If native species outdoes the nonnative then the nonnative species cannot become invasive and take over the ecosystem.

4 0
3 years ago
Other questions:
  • What are some of the basic characteristics that scientists consider when classifying living things?
    15·1 answer
  • Energy is released from atp when
    11·2 answers
  • How do the circulatory and respiratory system interact to provide muscle cells with oxygen during a long distance race?
    12·1 answer
  • The answer is 51.0 ml but can someone explain why please
    12·1 answer
  • Why do lunar and solar eclipses not happen every month?
    8·2 answers
  • How could two genetically identical oak trees have different heights when tree height is a heritable trait?
    11·1 answer
  • A population pyramid is an illustration that shows the
    12·2 answers
  • The diagram below represents some events that take place in plant cells. In which organelle will this occur?
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which is required for anaerobic respiration?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!