1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zepelin [54]
3 years ago
8

Metabolic pathways in which cells harvest energy from food molecule in the absence of oxygen is called____

Biology
2 answers:
BabaBlast [244]3 years ago
8 0

The answer is A. anaerobic cellular respiration.

notsponge [240]3 years ago
7 0
A. aerobic cellular respiration


You might be interested in
The frontal lobes also include the primary ____________ which controls voluntary motor functions.
lakkis [162]

Answer:

The correct answer will be- primary motor cortex

Explanation:

The motor cortex is the portion of the brain present in the precentral gyrus of the frontal lobe of the brain.  The motor cortex is thought to be involved in the planning actions and control voluntary actions.

The motor cortex is divided into three regions: premotor cortex, primary motor cortex  and supplementary motor area.

The primary motor cortex is the region of the motor cortex which controls the voluntary movements in the human body by generating the impulse.

Thus, the primary motor cortex is the correct answer.

5 0
3 years ago
Please help, I have no clue
Masteriza [31]

Answer:

freshwater fish

Explanation:

7 0
2 years ago
Read 2 more answers
What would happen if the producers were removed from an ecosystem?
Elden [556K]
If producers were removed from an ecosystem, it would fall apart. Producers are the organisms at the bottom of the food chain, which produce glucose and nutrients for consumers. If producers were removed from an ecosystem, the consumers would have no nutrients and die, causing their predators to die, and so on.
7 0
3 years ago
Why did the size of the caribou population decrease?
Katyanochek1 [597]

Answer:

The herds have been declining in recent decades due to a complicated mix of factors including hunting, disease, diminished food availability, and climate change, the report explains.

7 0
2 years ago
Describe Newton’s second law of motion. In your response, discuss how an object’s mass or the force that is exerted on the objec
Ann [662]

Answer:

Newton’s second law of motion is more quantitative and is used extensively to calculate what happens in situations involving a force. The greater the force that is applied to an object of a given mass, the more the object will accelerate.

Explanation:

For example, doubling the force on the object doubles its acceleration.

Example 1: Pushing a bicycle or a Cadillac, or stopping them once moving. The more massive the object (more inertia) the harder it is to start or stop.

7 0
3 years ago
Other questions:
  • Why are small rocks more susceptible to chemical weathering?
    6·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Stale air does not get trapped in amphibian lungs because it flows through a system of tubes and air sacs.
    8·1 answer
  • Which difference between water and ice results in ice floating on cold water?
    14·1 answer
  • Double membrane that separates the nucleus from the cytoplasm
    5·1 answer
  • Please Help, I Am Very Confused By This Question. Photos Are Linked!
    13·1 answer
  • how come honey bees all across the world are disappearing and dying? how can we stop / prevent this from happening ?
    5·1 answer
  • Compare how natural selection selects for organisms with beneficial traits over those with less beneficial traits for an environ
    7·1 answer
  • Imagine that these animals lived in a costal habitat, Due to global warming, sea level rise and the area was flooded. Which grou
    12·2 answers
  • Mendel crossed homozygous tall and short plants. The law of segregation dictates that each sperm of the tall plant randomly pass
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!