1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
4 years ago
14

A human cell has a mutation in the gene that encodes the enzyme that generates lactate from pyruvate, rendering that enzyme comp

letely non-functional.
Assuming that there is ample glucose present, how would this cell generate energy in the presence of oxygen?

A) Glycolysis coupled with ethanol fermentation.
B) Aerobic respiration.
C) Primarily through the break down of proteins into amino acids.
D) This cell would have no way to generate energy under these conditions. because it cannot carry out the reactions needed for glycolysis
Biology
1 answer:
Liono4ka [1.6K]4 years ago
7 0

Answer:

<h2>B</h2>

Explanation:

Glycolysis is the process of production of pyruvate from glucose by various enzymatic steps.

This pyruvate is further used in different ways;  as it is differently used in the presence of oxygen or in the absence of oxygen.

In the absence of oxygen, lactate is generated form  pyruvate, as given here, if this enzyme is non-functional, then lactate would not be produced.

In the presence of oxygen, pyruvate is oxidized in TCA cycle and finally through electron transport chain, energy in generated.

You might be interested in
Which of the following is an example of an extended product responsibility? Select one: a. ecotourism b. soft loans for business
igor_vitrenko [27]

Answer:

Which of the following is an example of an extended product responsibility? Select one:

a. ecotourism

b. soft loans for business planning to implement environmental products

<h2><em><u>c. the use of recycled wood products in the manufacture of new products </u></em></h2>

d. tradable emission permits

5 0
4 years ago
Which molecule most likely has the greatest amount of stored energy in its bonds
oksian1 [2.3K]

I need photos to see what the problem is.

6 0
4 years ago
Why do the walls of the stomach secrete hydrochloric acid? ​
Agata [3.3K]

Answer: sorry I’m to lazy to type

:)))

4 0
3 years ago
(d) Interactions between cyclins and cyclin-dependent kinases control the cell cycle. Explain how the presence or absence of inh
Artist 52 [7]

Answer:

Inhibitors of cyclin-dependent kinases might play a role in regulating the concentration of cyclin in the cell cycle.

Explanation:

The presence of inhibitors of cyclin-dependent kinases has a great importance because it controls the concentration of cyclin that is necessary for the cell cycle. If inhibitors of cyclin-dependent kinases is absent , the amount of cyclin increases in the cell formation and cause  a great damage to the cell cycle and the cell which is produced is abnormal or other irregularities.

5 0
4 years ago
WILL GIVE BRAINLIEST!!
Fiesta28 [93]

Explanation:

B. education pls mark brainliest if this helps :)

7 0
3 years ago
Read 2 more answers
Other questions:
  • Mites are tiny organisms that can ride on top of insects such as beetles in order to move quickly from place to place. Mites do
    5·2 answers
  • Which of the following are found in cell membranes? a lipids b DNA c RNA d glucose
    11·1 answer
  • What does DNA contain?
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Use your understanding of the nitrogen cycle to answer
    5·1 answer
  • Looking at the picture above, what amino acid was brought in by the tRNA molecule that is circled?
    10·1 answer
  • The white matter of the cerebellum forms the
    6·1 answer
  • While building a home, a family had to choose between granite and marble stairs. Which one would be more resistant to physical w
    13·1 answer
  • Tina used 500 N of force to move a desk. The desk weighed 300 N, and she
    6·1 answer
  • Is my answer correct<br><br><br> pls check asap!!<br><br><br> no time!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!