1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
3 years ago
15

Whats the weather in the usa today good or bad

Biology
1 answer:
Sidana [21]3 years ago
4 0

Answer:

good i guess

Explanation:

i guess lol

You might be interested in
Why would it be hard to find the ideal co₂ level of the light intensity were low?
Natalka [10]
In low light no plants grow. With no plants no animals can eat so less animals remain or stay there. With less animals less animals respire and breathe out CO2.
6 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Which of the following is an example of how enzymes are catalyst?
hoa [83]
It’s D girlyyyyyyyyyyy
3 0
3 years ago
If you want brainlist answer my questions and you will get it ​
pashok25 [27]

Answer:

ti teg lliw uoy dna snoitseuq rewsna tsilniarb tnaw uoy fi

Explanation:

mirror

7 0
3 years ago
A combination is a substance formed when two or more different elements combine.<br> True or false
Sergeeva-Olga [200]

Answer:

False

Explanation:

Two or more elements combine to forma COMPOUND.

4 0
3 years ago
Other questions:
  • The type of tissue that covers body surfaces lines body cavities and forms glands is
    7·1 answer
  • True or false: light independent reactions utilize pigments, involve the electron transport system, and are relatively fast reac
    5·1 answer
  • What happens during glycolysis in cellular respiration?
    7·1 answer
  • Question 4 Multiple Choice Worth 2 points)
    8·1 answer
  • Why does the northern hemisphere experience Spring in March, while the Southern Hemisphere experiences fall?
    9·2 answers
  • What is the effect of alcohol administration on the frequency of Daphnia heart contractions and how does this effect of alcohol
    12·1 answer
  • AHGCACHG-DNA
    6·1 answer
  • Will give brainliest
    11·1 answer
  • Which of the following shows the difference between aerobic and anaerobic respiration respiration?
    11·1 answer
  • Use the four population pyramids above to answer the question. Which country's population is
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!