1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina CMI [18]
3 years ago
5

The largest or most important part of an organ is termed the

Biology
1 answer:
masha68 [24]3 years ago
4 0
Hello, this would be known as the sim/o.
Hope this helps<3
You might be interested in
Approximately how much of Earth’s surface is water? 100% 75% 50% 25%
lora16 [44]

Answer: 75%

Thats just the way it is

4 0
3 years ago
Read 2 more answers
What do you call a trait caused by a gene on chromosome 1?
andrew-mc [135]
I'm guessing the answer is a
5 0
3 years ago
1. Suppose all of the seed tests were done at the same time in the same type of soil and weather
lukranit [14]

Answer:

High quality of seeds.

Explanation:

92% of the seeds in a seed  package will sprout if it has high quality because good quality seeds has the ability to germinate more than those seeds which are not of good quality. If the seed has high quality, it has more than 90% germination rate. If the seeds are infected by some disease or damaged due to mechanical means so these factors also affected the rate of germination.

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Sunlight-Rose-Honeybee-Skunk-Eagle
postnew [5]

The rose population would decrease because the bees would need more food. Since the skunk has more food, it would increase and the eagle population would probably increase too because of more access to skunks. The eagle interpretation may be true unless the eagle is perceived as a scavenger. Then the population would most likely stay the same. The sun would stay the same because it is an abiotic factor in an ecosystem. your welcome fam

4 0
3 years ago
Read 2 more answers
Other questions:
  • If a contact downloads a piece of your content, such as a newsletter titled, "the best ways to create subject lines for email,"
    8·2 answers
  • Which material most likely has the highest level of permeability?
    15·2 answers
  • A ___________________ is a multicellular haploid form and a ____________________ is a multicellular diploid form in a plant that
    11·1 answer
  • How many copies of the 1st chromosome does a human haploid cell contain
    15·1 answer
  • What are the symptoms of West Nile virus?
    6·1 answer
  • Hair would be dry and brittle without the presence of? A) sebaceous glands B) keratin C) melanin D) fat
    9·2 answers
  • Yeast cells are recovered from a fermentation broth by using a tubular centrifuge. Sixty percent of the cells are recovered at a
    7·1 answer
  • A scientist goes on an expedition to Greenland and finds an unknown organism. She then analyzes the DNA and confirms that the st
    13·1 answer
  • 1.What is a codon? What does it tell the ribosome?
    12·1 answer
  • What is an insect's antennae most similar too?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!