Because we do or we would die
It is described as relatively non specific
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
1. interactions
2. environment
3. sun
4. photosynthesis
5. chemical
6. producers
7. food
8. energy
9. organisms
10. herbivores
10. first
12. Heterotrophs
13. second
Explanation:
An ecosystem consists of a community of living organisms
interacting with each other and the environment. The source of energy that fuels most ecosystems is the sun. Plants use the Sun’s energy to produce food in a process called photosynthesis.
Organisms that use energy from the Sun or energy stored in chemical compounds to produce their own nutrients are called autotrophs. They are also called producers because most other organisms depend on autotrophs for food and energy. Heterotrophic organisms that can’t make their own food may obtain nutrients by eating other organisms. A heterotroph that feeds only on plants is called an herbivore. Herbivores are also called first order heterotrophs. Heterotrophs that feed on other herbivores are second order heterotrophs.
Answer:
The students with the purple shirts are moving through the gym doors most often.
Explanation:
- The students with the purple shirts represent potassium ions
- Potassium ions move freely across the membrane by passive transport and are important in maintaining membrane potentials
- The movement of sodium ions is through active transport therefore this is a process that requires energy (ATP) and thus these ions are less likely to move across the membrane often
