1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aneli [31]
3 years ago
11

What telescope was launched in 1990 and takes very detailed pictures of the universe?

Biology
1 answer:
katen-ka-za [31]3 years ago
4 0
The <span>Hubble Space Telescope was the telescope that was launched in 1990.</span>
You might be interested in
What is hanta virus????
Zigmanuir [339]
Hanta virus is a type of virus that usually infects rodents and not humans. :) hope I helped
3 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Choose the best scientific design to test the question “Which soil type results in the highest yield of tomatoes: clay soil or s
Alexxandr [17]
The best answer would be letter D. C<span>ompare the average number of tomatoes that are produced by 10 tomato plants that are grown in clay soil to the average number of tomatoes that are produced by 10 tomato plants that are grown in sandy soil.

It would be best to grow more than one tomato plant in each soil to truly represent the tomato's growth in them. To average the number of tomatoes yielded by each soil sample would also allow a sample that is more representative of the tomato plants than merely comparing single tomato plants. 

</span>
3 0
3 years ago
Why do organs need a constant supply of blood?
Alekssandra [29.7K]

Answer:

to continually produce energy,your organs need oxygen and the oxygen  is carried in your red blood cells.

6 0
3 years ago
Read 2 more answers
An ecosystem that retains structure &amp; continues normal functions even when environmental conditions change is
Marina86 [1]
Reconciled. I hope this helps
3 0
3 years ago
Other questions:
  • What are four resources that can be obtained from the ocean?
    10·1 answer
  • Matching pls help I tried using my notes
    11·1 answer
  • Energy enters most ecosystems as sunlight. Within an ecosystem, energy is transformed, used, and exits the ecosystem as heat. Dr
    15·1 answer
  • City officials are proposing a recycling program. They must examine the benefits to their community, not just the environment, t
    12·2 answers
  • Using an ultraviolet light to test for ringworm is known as what test? wood's lamp test black lighting test fungus culture test
    13·1 answer
  • What is the underlying cause of cancer?
    13·1 answer
  • What is the composition of a DNA fragment?
    8·1 answer
  • Urban Sprawl is _____.
    7·2 answers
  • Need some help please!!!!!
    8·2 answers
  • Which of the following is NOT a reactant
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!