Name the scientific term for inability of myosin to detach from actin fibers?
1 answer:
You might be interested in
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
