1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
3 years ago
12

The equation y = 8x + 12, where x is the number of hours and y is the total cost, represents what the surf instructor charges fo

r lessons. Use this information to describe how to draw the line on a graph.
Biology
2 answers:
irinina [24]3 years ago
9 0
Simple problem my friend!

First we must replace X with -2,-1,0,1,2
then we plug in -2 in X. 8*-2 is -16 and adding 12 gives us a co ordinate of (-2,-4) now this is not enough so now we must do -1. 8*-1 is -8, + 12 gives us 4. so now our second co ordinate is (-1,4). i will do 1 more co ordinate and then you should be able to finish the problem by yourself :) we now plug in 0 to replace X. 8*0 is 0, easy and 0+12 is 12. so the third co ordinate is (0,12) when you have put all the dots on the graph be sure to draw a line through them and by the way, this is not a biology question lol, good luck!
Brianna bts
3 years ago
Thxs and thxs for the extra info (!) __(!)
ki77a [65]3 years ago
5 0

Answer:

   Use rise/run  from (0, 12).

8 up and 1 to the right to (1, 20)

Draw a line through the points (0, 12), (1, 20).

Verify the equation by testing an additional point.

Explanation:

Brianna bts
3 years ago
thxs and really needed
You might be interested in
Which quality makes Earth particularly well-suited to support life?
Vaselesa [24]
I would say D narrow temperature. Most other planets are too hot or cold to sustain life.
3 0
3 years ago
Help me plss, I will brainliest
Sophie [7]

Answer:

intrusive igneous rocks cool from magma slowly because they are BURIED beneath the surface extrusive igneous rocks cool from lava rapidly because they form at the surface and the meaning of those words are simple intrusive means inside of something like interior and extrusive means outside which is like exterior

7 0
3 years ago
Which of the following statements is true? Natural energy sources are nonrenewable and being depleted. Current fuels are not pol
Dennis_Churaev [7]
The first sentence is correct....
6 0
3 years ago
Read 2 more answers
Which zone within the open-ocean zone is home to the most organisms?Which zone within the open-ocean zone is home to the most or
BabaBlast [244]

<em><u>Answer:</u></em>

<em><u>epipelagic zone</u></em>

<em><u>Explanation:</u></em>

<em><u>The epipelagic zone is home to most organisms because it is the sunlit upper layer of the ocean. it is also know as the photic or euphotic zone</u></em>

3 0
3 years ago
What are possible benefits of studying Biology?
IRINA_888 [86]
Science means to know. Biology is the study of living things.
You understand a lot more of the function of the body (EMT, healthcare, diseases, etc.)
animals (veterinary work,etc.) You will understand the intro into genetics, and the ways in which the sun and plants directly influences our entire world.
Biology is a form of science that is pretty broad, and at the same time a form of science you can use in every day life of understanding the basic things that happen around you (in culture, family, news, environment, behavioural, etc.)
Biology is also a great way to get your feet wet into basic science- a launching pad for chemistry, physics, etc. Hope this helped. :)

5 0
4 years ago
Read 2 more answers
Other questions:
  • How are genes and proteins related?
    12·2 answers
  • How do the number of muscles in a cow eye compare with that of a human eye, and what does this mean for each organism?
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Cytosine has 30% so thymine would have what percent?
    8·1 answer
  • Which of the following statements about viruses is true?
    7·1 answer
  •  For each phenotype, write the possible genotypes.
    5·1 answer
  • PLEASE HELP ME ITS FOR SCIENCE DUE TODAY!! (Punnett Squares!)
    12·1 answer
  • The outer cell membrane is a type of exotoxin produced by bacteria. True False
    7·1 answer
  • Mucus that protects your stomach lining is secreted by which type of epithelial cell?.
    5·1 answer
  • If the dna triplets is atg-cgt, the trna anticodons are group of answer choices atg-cgt. Uag-cgu. Aug-cgu. Uac-gca
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!