1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GarryVolchara [31]
3 years ago
10

For constipation, which grain, fruit, legume and vegetable would you recommend (based on chart below)

Biology
1 answer:
tester [92]3 years ago
5 0
Good sources of dietary fiber including fruits vegetables, legumes and whole grains are highly recommended when one has constipation. Therefore; For constipation; i would recommend legumes such as beans, peas, and Lentils; Vegetables including Brococoli, spinach, The whole grains such as oatmeal, chia seeds, or flaxseeds, fruits such as berries, pears, apples and dried fruits.
You might be interested in
What little light there is in the deep ocean is provided by
Lena [83]

Answer:

animales

Explanation:

animales como medusas o pirañas

6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
one important difference between living things (biotic) and nonliving things (abiotic) is that only living things have
Mamont248 [21]
The answer is: D. Cells
7 0
3 years ago
Read 2 more answers
2
Lady bird [3.3K]
A function of the nucleus is D) Storing genetic material.
5 0
3 years ago
This table is dirty. near far plural singular
denis23 [38]

Answer: Singular

Hope this helps

Explanation:

8 0
3 years ago
Other questions:
  • In what ways would understanding the body position,directions, and planes assist you with tasks related to the integumentary, sk
    13·2 answers
  • In the condition ________, a virus infects posterior root ganglia, causing a painful rash whose distribution corresponds to that
    12·1 answer
  • How much weight can a giant insect bear?
    14·1 answer
  • The skin around a cut becomes red and warm as part of the
    9·2 answers
  • What do you notice about the temperature at each of the layers boundaries
    6·1 answer
  • When the digestion and absorption of carbohydrates result in more energy-rich molecules than are immediately required by an anim
    11·2 answers
  • Which of these Earth systems is most responsible for the increases in global warming
    14·2 answers
  • A standardized taxonomic system is valuable because it helps biologists agree on methods to
    10·1 answer
  • Describe the carbon atom:
    15·2 answers
  • Which of the choices below describes the pathway of cellular respiration (the complete oxidation of glucose)? lipolysis, glycoge
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!