1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nezavi [6.7K]
3 years ago
10

Webbed feet to help with swimming is it physical or behavior adaptation ​

Biology
1 answer:
Marta_Voda [28]3 years ago
7 0

Answer:

It is a physical adaptation

Explanation:

Webbed feet does not change the way the animal acts but it had to adapt webbed feet physically to survive in its habitat/surroundings

You might be interested in
Compare sequence 2 with sequence 1 and describe the mutaton that has occured.
svetlana [45]
Where’s the sequence??
4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
A father produces sperm that only carry ‘t’ alleles. What is likely to be his genotype?
Sav [38]

Answer:

The Genotype of an organism determines the genetic characteristics of an individual.

If a father produces sperm that carry only 't' alleles, the his genotype will be 'tt' or hom.ozygous genotype.

Hom.ozygous genotype contains the same type of genes responsible for a particular phenotype.

Hence, the correct answer is 'tt' or hom.ozygous genotype.

8 0
3 years ago
Sometimes a new experimental result may seem to go against a well-established scientific theory. Which statement BEST describes
attashe74 [19]

C.) New results should be verified by more experiments before it is accepted

3 0
3 years ago
The study of the whole economy is called _____.
Anni [7]
Answers – 
1. Macroeconomics
2. Economic cycle

1. Macroeconomics refers to the study of the whole economy and how it behaves. It is a branch of the field of economics which carefully examines various economy-wide phenomena like, inflation, price levels, national income, GDP (gross domestic product), growth rate, and changes in unemployment.

2. The time from one economic peak to another economic peak is called the economic cycle. Like a roller coaster ride, the economic cycle is more or less like a behavioral pattern in the economy that consist of both growing and shrinking phases
5 0
4 years ago
Read 2 more answers
Other questions:
  • The nurse hears a pregnant client yell, "oh my! the baby is coming!" after placing the client in a supine position and trying to
    10·2 answers
  • Briefly describe how the process of translation is started
    10·1 answer
  • What is the primary function of the lymphatic system?
    13·2 answers
  • . Corn has small, colorless, odorless, lightweight flowers without petals. What is the significance of these flowers in the poll
    10·2 answers
  • Describe four ways that species are being threatened with extinction globally
    12·2 answers
  • If a population grows larger the. It’s environmental carrying capacity then
    10·1 answer
  • Show me a picture of telophase stage of mitosis
    11·1 answer
  • What are the characteristics of a multi celled organism
    13·1 answer
  • What is the function of mRNA in the diagram above?
    5·1 answer
  • Photosynthesis transforms blank into chemical energy by blank sugars. Cellular respiration releases the blank from food by blank
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!